Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639328_at:

>probe:Drosophila_2:1639328_at:525:701; Interrogation_Position=1028; Antisense; TTTTGCGTTTTTTCATGCTGCTCAC
>probe:Drosophila_2:1639328_at:136:363; Interrogation_Position=1075; Antisense; GAATTAAACAAGCTCCTCTGGCGGC
>probe:Drosophila_2:1639328_at:616:637; Interrogation_Position=1091; Antisense; TCTGGCGGCTTTTATTTCTGTATGT
>probe:Drosophila_2:1639328_at:451:435; Interrogation_Position=1125; Antisense; GAGGTTTATGTAGCTCTTTGTCAAA
>probe:Drosophila_2:1639328_at:170:707; Interrogation_Position=588; Antisense; TTACGGCCTACACTATTGCCTTTGG
>probe:Drosophila_2:1639328_at:563:721; Interrogation_Position=603; Antisense; TTGCCTTTGGCATCAGGAACTGCAC
>probe:Drosophila_2:1639328_at:717:613; Interrogation_Position=649; Antisense; TGAAGCGTATCGAGTGCTGCAGCCG
>probe:Drosophila_2:1639328_at:268:557; Interrogation_Position=677; Antisense; GGACGATTCATGTGCCTGGAGTTCA
>probe:Drosophila_2:1639328_at:648:569; Interrogation_Position=729; Antisense; GGCTATATGACCAGTACTCCTTCCA
>probe:Drosophila_2:1639328_at:235:349; Interrogation_Position=793; Antisense; GCAGGCGTACCAGTATCTCGTTGAG
>probe:Drosophila_2:1639328_at:709:631; Interrogation_Position=808; Antisense; TCTCGTTGAGAGCATCCGACGGTTT
>probe:Drosophila_2:1639328_at:179:407; Interrogation_Position=825; Antisense; GACGGTTTCCCAAGCAGGAGCAATT
>probe:Drosophila_2:1639328_at:68:71; Interrogation_Position=867; Antisense; AGGCCGGATTCGATCAGGTGTCCTA
>probe:Drosophila_2:1639328_at:465:421; Interrogation_Position=893; Antisense; GAGAACCTAACCTTCGGCGTGGTCA

Paste this into a BLAST search page for me
TTTTGCGTTTTTTCATGCTGCTCACGAATTAAACAAGCTCCTCTGGCGGCTCTGGCGGCTTTTATTTCTGTATGTGAGGTTTATGTAGCTCTTTGTCAAATTACGGCCTACACTATTGCCTTTGGTTGCCTTTGGCATCAGGAACTGCACTGAAGCGTATCGAGTGCTGCAGCCGGGACGATTCATGTGCCTGGAGTTCAGGCTATATGACCAGTACTCCTTCCAGCAGGCGTACCAGTATCTCGTTGAGTCTCGTTGAGAGCATCCGACGGTTTGACGGTTTCCCAAGCAGGAGCAATTAGGCCGGATTCGATCAGGTGTCCTAGAGAACCTAACCTTCGGCGTGGTCA

Full Affymetrix probeset data:

Annotations for 1639328_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime