FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639331_at:

>probe:Drosophila_2:1639331_at:156:393; Interrogation_Position=1013; Antisense; GAAAGCTGACTCTAACGCTTCTGGC
>probe:Drosophila_2:1639331_at:479:715; Interrogation_Position=1031; Antisense; TTCTGGCCAAGTCGACGTTGTACAC
>probe:Drosophila_2:1639331_at:662:341; Interrogation_Position=521; Antisense; GCTTTTACTTTCTGCTCTGGGAAAT
>probe:Drosophila_2:1639331_at:294:55; Interrogation_Position=577; Antisense; ATGACACTCATTTTGGCCAGGTCGG
>probe:Drosophila_2:1639331_at:410:99; Interrogation_Position=623; Antisense; AGATGCAGCACTGCCTTAGACTCTA
>probe:Drosophila_2:1639331_at:664:675; Interrogation_Position=639; Antisense; TAGACTCTACTCCAAGCTTCTACTG
>probe:Drosophila_2:1639331_at:360:505; Interrogation_Position=729; Antisense; GTGCCAGATCACCTTTGGCTACGAA
>probe:Drosophila_2:1639331_at:627:243; Interrogation_Position=753; Antisense; AATATTCCAGATGGTGGCTGCCCCA
>probe:Drosophila_2:1639331_at:114:573; Interrogation_Position=768; Antisense; GGCTGCCCCAAAGTCAATCGATTTA
>probe:Drosophila_2:1639331_at:616:447; Interrogation_Position=835; Antisense; GATGCCATGAACCTATTTCTTGGAA
>probe:Drosophila_2:1639331_at:706:401; Interrogation_Position=862; Antisense; GACATTTCCGAGTTGTTCAGTACTT
>probe:Drosophila_2:1639331_at:157:425; Interrogation_Position=916; Antisense; GAGACCAGTCGCTTGGATCGTTTGC
>probe:Drosophila_2:1639331_at:31:691; Interrogation_Position=936; Antisense; TTTGCTCTCCATGTTCGCCTTGAAG
>probe:Drosophila_2:1639331_at:246:207; Interrogation_Position=976; Antisense; AAGCGGGTCGTCTTACTCAACGTGT

Paste this into a BLAST search page for me
GAAAGCTGACTCTAACGCTTCTGGCTTCTGGCCAAGTCGACGTTGTACACGCTTTTACTTTCTGCTCTGGGAAATATGACACTCATTTTGGCCAGGTCGGAGATGCAGCACTGCCTTAGACTCTATAGACTCTACTCCAAGCTTCTACTGGTGCCAGATCACCTTTGGCTACGAAAATATTCCAGATGGTGGCTGCCCCAGGCTGCCCCAAAGTCAATCGATTTAGATGCCATGAACCTATTTCTTGGAAGACATTTCCGAGTTGTTCAGTACTTGAGACCAGTCGCTTGGATCGTTTGCTTTGCTCTCCATGTTCGCCTTGAAGAAGCGGGTCGTCTTACTCAACGTGT

Full Affymetrix probeset data:

Annotations for 1639331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720