FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639332_at:

>probe:Drosophila_2:1639332_at:474:417; Interrogation_Position=435; Antisense; GGAGTTGGTAAATCGGCCCTTACAG
>probe:Drosophila_2:1639332_at:35:277; Interrogation_Position=453; Antisense; CTTACAGTGCAATTCGTCTCGGGAT
>probe:Drosophila_2:1639332_at:224:247; Interrogation_Position=463; Antisense; AATTCGTCTCGGGATGCTTTATTGA
>probe:Drosophila_2:1639332_at:506:337; Interrogation_Position=541; Antisense; GCTCGCCGTGCGTCTTGGAAATATT
>probe:Drosophila_2:1639332_at:488:395; Interrogation_Position=558; Antisense; GAAATATTGGACACCGCGGGCACAG
>probe:Drosophila_2:1639332_at:562:525; Interrogation_Position=575; Antisense; GGGCACAGAGCAATTCGCATCCATG
>probe:Drosophila_2:1639332_at:539:611; Interrogation_Position=706; Antisense; TGAAAGGAAGTCAGCCAGCACCCAT
>probe:Drosophila_2:1639332_at:115:309; Interrogation_Position=727; Antisense; CCATCCTACTAGTCGCGAACAAATT
>probe:Drosophila_2:1639332_at:205:7; Interrogation_Position=760; Antisense; ATTGCCAAAGAGAGGTATCCACCGC
>probe:Drosophila_2:1639332_at:691:681; Interrogation_Position=775; Antisense; TATCCACCGCTGAAGGTAATGCCTT
>probe:Drosophila_2:1639332_at:575:583; Interrogation_Position=799; Antisense; TGGCACAACTGTGGGACTGTCCATT
>probe:Drosophila_2:1639332_at:26:143; Interrogation_Position=814; Antisense; ACTGTCCATTTATCGAGGCATCTGC
>probe:Drosophila_2:1639332_at:566:689; Interrogation_Position=865; Antisense; TATTCGCCACCATCGTTCGAGAGAT
>probe:Drosophila_2:1639332_at:598:143; Interrogation_Position=925; Antisense; ACTGTTGTTGTACGCTTTTATAGAA

Paste this into a BLAST search page for me
GGAGTTGGTAAATCGGCCCTTACAGCTTACAGTGCAATTCGTCTCGGGATAATTCGTCTCGGGATGCTTTATTGAGCTCGCCGTGCGTCTTGGAAATATTGAAATATTGGACACCGCGGGCACAGGGGCACAGAGCAATTCGCATCCATGTGAAAGGAAGTCAGCCAGCACCCATCCATCCTACTAGTCGCGAACAAATTATTGCCAAAGAGAGGTATCCACCGCTATCCACCGCTGAAGGTAATGCCTTTGGCACAACTGTGGGACTGTCCATTACTGTCCATTTATCGAGGCATCTGCTATTCGCCACCATCGTTCGAGAGATACTGTTGTTGTACGCTTTTATAGAA

Full Affymetrix probeset data:

Annotations for 1639332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720