Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639333_at:

>probe:Drosophila_2:1639333_at:37:577; Interrogation_Position=1327; Antisense; GGCGCCTCCTCAAATGCCAGTTGGA
>probe:Drosophila_2:1639333_at:272:95; Interrogation_Position=1345; Antisense; AGTTGGAGTCCAGCCTGCTCAGCTT
>probe:Drosophila_2:1639333_at:33:263; Interrogation_Position=1376; Antisense; CAGCATCTGGTTGGGATCGCCTTGA
>probe:Drosophila_2:1639333_at:671:409; Interrogation_Position=1399; Antisense; GACCCAACAGGCCTCGAGTCTATCG
>probe:Drosophila_2:1639333_at:350:533; Interrogation_Position=1441; Antisense; GGTGGCCCTGACTTTGTCGCACTCT
>probe:Drosophila_2:1639333_at:608:119; Interrogation_Position=1519; Antisense; AGCTGCAACGCCACCCGAGGACAGG
>probe:Drosophila_2:1639333_at:247:629; Interrogation_Position=1553; Antisense; TCCATTGCCGCACTGCGTCTGAAGG
>probe:Drosophila_2:1639333_at:339:69; Interrogation_Position=1575; Antisense; AGGCGAGAGAGCACGAACTGAAACT
>probe:Drosophila_2:1639333_at:92:391; Interrogation_Position=1594; Antisense; GAAACTGGAACTGTTGCGTCAGAAT
>probe:Drosophila_2:1639333_at:512:391; Interrogation_Position=1626; Antisense; GAAACGATGTGGTCAGCTAGCTGGT
>probe:Drosophila_2:1639333_at:14:137; Interrogation_Position=1685; Antisense; ACGAAGGTCAGCGAGGATTCCCCAA
>probe:Drosophila_2:1639333_at:664:435; Interrogation_Position=1697; Antisense; GAGGATTCCCCAAACCCAAGTGCAA
>probe:Drosophila_2:1639333_at:400:215; Interrogation_Position=1723; Antisense; AAGATTTCCAATTCACTGCAGTCCT
>probe:Drosophila_2:1639333_at:699:711; Interrogation_Position=1767; Antisense; TTGTATTTACCTAAGCTCCAATTTT

Paste this into a BLAST search page for me
GGCGCCTCCTCAAATGCCAGTTGGAAGTTGGAGTCCAGCCTGCTCAGCTTCAGCATCTGGTTGGGATCGCCTTGAGACCCAACAGGCCTCGAGTCTATCGGGTGGCCCTGACTTTGTCGCACTCTAGCTGCAACGCCACCCGAGGACAGGTCCATTGCCGCACTGCGTCTGAAGGAGGCGAGAGAGCACGAACTGAAACTGAAACTGGAACTGTTGCGTCAGAATGAAACGATGTGGTCAGCTAGCTGGTACGAAGGTCAGCGAGGATTCCCCAAGAGGATTCCCCAAACCCAAGTGCAAAAGATTTCCAATTCACTGCAGTCCTTTGTATTTACCTAAGCTCCAATTTT

Full Affymetrix probeset data:

Annotations for 1639333_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime