FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639334_at:

>probe:Drosophila_2:1639334_at:495:23; Interrogation_Position=1025; Antisense; ATATCTTCAAGCTCTCGGATTGGCC
>probe:Drosophila_2:1639334_at:577:539; Interrogation_Position=1041; Antisense; GGATTGGCCATTCGGCATTTAATCA
>probe:Drosophila_2:1639334_at:599:107; Interrogation_Position=1065; Antisense; AGAACTGGTTGCCATGCAGCACCAA
>probe:Drosophila_2:1639334_at:248:271; Interrogation_Position=1099; Antisense; CATCCTGCAATTTATTATCGCGCGC
>probe:Drosophila_2:1639334_at:116:673; Interrogation_Position=1153; Antisense; TACCTTTCCACCCATATCTTTTAAT
>probe:Drosophila_2:1639334_at:482:685; Interrogation_Position=1205; Antisense; TATCAGTTTTTTGCACTGCTCCGCA
>probe:Drosophila_2:1639334_at:226:551; Interrogation_Position=662; Antisense; GGAGTTTCCTACGTCTGCGTGGATC
>probe:Drosophila_2:1639334_at:57:121; Interrogation_Position=711; Antisense; AGCTGACCATGCACTTCAACTTTAT
>probe:Drosophila_2:1639334_at:325:191; Interrogation_Position=803; Antisense; AACTTGGTCGTCTATCATGCCAGGG
>probe:Drosophila_2:1639334_at:727:687; Interrogation_Position=858; Antisense; TATTCAGCTTCCTGATCCTGTGGAA
>probe:Drosophila_2:1639334_at:700:593; Interrogation_Position=876; Antisense; TGTGGAACTTTATTGCCGCATCGCT
>probe:Drosophila_2:1639334_at:457:723; Interrogation_Position=907; Antisense; TTGCTTCGCTGGCTTTCAGATTACA
>probe:Drosophila_2:1639334_at:669:633; Interrogation_Position=980; Antisense; TCGCTGGTTCAAGTCTTTGTGGTCT
>probe:Drosophila_2:1639334_at:258:729; Interrogation_Position=996; Antisense; TTGTGGTCTGTTACTACGGCGATGA

Paste this into a BLAST search page for me
ATATCTTCAAGCTCTCGGATTGGCCGGATTGGCCATTCGGCATTTAATCAAGAACTGGTTGCCATGCAGCACCAACATCCTGCAATTTATTATCGCGCGCTACCTTTCCACCCATATCTTTTAATTATCAGTTTTTTGCACTGCTCCGCAGGAGTTTCCTACGTCTGCGTGGATCAGCTGACCATGCACTTCAACTTTATAACTTGGTCGTCTATCATGCCAGGGTATTCAGCTTCCTGATCCTGTGGAATGTGGAACTTTATTGCCGCATCGCTTTGCTTCGCTGGCTTTCAGATTACATCGCTGGTTCAAGTCTTTGTGGTCTTTGTGGTCTGTTACTACGGCGATGA

Full Affymetrix probeset data:

Annotations for 1639334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720