FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639336_at:

>probe:Drosophila_2:1639336_at:641:277; Interrogation_Position=20; Antisense; CTATTCTTGCGCTATCCCTGGCCGT
>probe:Drosophila_2:1639336_at:323:309; Interrogation_Position=230; Antisense; CCACCACAAGCACAACTGAGGAGTC
>probe:Drosophila_2:1639336_at:439:251; Interrogation_Position=236; Antisense; CAAGCACAACTGAGGAGTCCAAGAA
>probe:Drosophila_2:1639336_at:508:431; Interrogation_Position=250; Antisense; GAGTCCAAGAAGAAACATCGCCGCA
>probe:Drosophila_2:1639336_at:321:211; Interrogation_Position=256; Antisense; AAGAAGAAACATCGCCGCAGGCACC
>probe:Drosophila_2:1639336_at:396:271; Interrogation_Position=294; Antisense; CATCATCATCCGACGCGTTGGCGGT
>probe:Drosophila_2:1639336_at:151:45; Interrogation_Position=301; Antisense; ATCCGACGCGTTGGCGGTGGATTAA
>probe:Drosophila_2:1639336_at:567:11; Interrogation_Position=321; Antisense; ATTAAGGCGCCGCAGAGAGCGCGAC
>probe:Drosophila_2:1639336_at:528:265; Interrogation_Position=333; Antisense; CAGAGAGCGCGACGGCGACGAGGAT
>probe:Drosophila_2:1639336_at:193:65; Interrogation_Position=356; Antisense; ATGGTGGCCGCGTCGTGAGGCGCAT
>probe:Drosophila_2:1639336_at:167:47; Interrogation_Position=379; Antisense; ATCCGTGTGCGCGAAGGAAGATTCA
>probe:Drosophila_2:1639336_at:92:227; Interrogation_Position=392; Antisense; AAGGAAGATTCAGGCGTCGTGATGC
>probe:Drosophila_2:1639336_at:397:95; Interrogation_Position=397; Antisense; AGATTCAGGCGTCGTGATGCCTTCT
>probe:Drosophila_2:1639336_at:525:267; Interrogation_Position=402; Antisense; CAGGCGTCGTGATGCCTTCTTCTAA

Paste this into a BLAST search page for me
CTATTCTTGCGCTATCCCTGGCCGTCCACCACAAGCACAACTGAGGAGTCCAAGCACAACTGAGGAGTCCAAGAAGAGTCCAAGAAGAAACATCGCCGCAAAGAAGAAACATCGCCGCAGGCACCCATCATCATCCGACGCGTTGGCGGTATCCGACGCGTTGGCGGTGGATTAAATTAAGGCGCCGCAGAGAGCGCGACCAGAGAGCGCGACGGCGACGAGGATATGGTGGCCGCGTCGTGAGGCGCATATCCGTGTGCGCGAAGGAAGATTCAAAGGAAGATTCAGGCGTCGTGATGCAGATTCAGGCGTCGTGATGCCTTCTCAGGCGTCGTGATGCCTTCTTCTAA

Full Affymetrix probeset data:

Annotations for 1639336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720