Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639337_at:

>probe:Drosophila_2:1639337_at:606:261; Interrogation_Position=2512; Antisense; CAGGTTGGAGTGTCCCCGAACAAGT
>probe:Drosophila_2:1639337_at:241:561; Interrogation_Position=2537; Antisense; GGAACAATTCCGGAAGCGATTACTT
>probe:Drosophila_2:1639337_at:276:189; Interrogation_Position=2563; Antisense; AACAGGACTCGCGATCTGAGGCAAC
>probe:Drosophila_2:1639337_at:300:39; Interrogation_Position=2576; Antisense; ATCTGAGGCAACTGTAGACTCCCCG
>probe:Drosophila_2:1639337_at:176:427; Interrogation_Position=2643; Antisense; GAGAGTCCAGCGCTGTTCAGAAGCA
>probe:Drosophila_2:1639337_at:535:711; Interrogation_Position=2658; Antisense; TTCAGAAGCAGTTCCCGCAAACGAT
>probe:Drosophila_2:1639337_at:300:317; Interrogation_Position=2690; Antisense; GCCGTTCTCTGGTGGCGAATCCAAA
>probe:Drosophila_2:1639337_at:709:255; Interrogation_Position=2711; Antisense; CAAACGACGTGACTATTCACCCGAA
>probe:Drosophila_2:1639337_at:26:161; Interrogation_Position=2751; Antisense; AAATCCTCGAAACGCAATCGGTCGC
>probe:Drosophila_2:1639337_at:703:235; Interrogation_Position=2766; Antisense; AATCGGTCGCGTAGTCCGTCCAGTT
>probe:Drosophila_2:1639337_at:275:379; Interrogation_Position=2795; Antisense; GAAGCGGTATACAGAGCGGTCGTCT
>probe:Drosophila_2:1639337_at:563:265; Interrogation_Position=2897; Antisense; CAGAGAAGAGCCATCGCCGCCGAGA
>probe:Drosophila_2:1639337_at:299:25; Interrogation_Position=2950; Antisense; ATAGGCACTAGAGTGTCTGCTCTTC
>probe:Drosophila_2:1639337_at:584:499; Interrogation_Position=2964; Antisense; GTCTGCTCTTCGGACGATTTGTATT

Paste this into a BLAST search page for me
CAGGTTGGAGTGTCCCCGAACAAGTGGAACAATTCCGGAAGCGATTACTTAACAGGACTCGCGATCTGAGGCAACATCTGAGGCAACTGTAGACTCCCCGGAGAGTCCAGCGCTGTTCAGAAGCATTCAGAAGCAGTTCCCGCAAACGATGCCGTTCTCTGGTGGCGAATCCAAACAAACGACGTGACTATTCACCCGAAAAATCCTCGAAACGCAATCGGTCGCAATCGGTCGCGTAGTCCGTCCAGTTGAAGCGGTATACAGAGCGGTCGTCTCAGAGAAGAGCCATCGCCGCCGAGAATAGGCACTAGAGTGTCTGCTCTTCGTCTGCTCTTCGGACGATTTGTATT

Full Affymetrix probeset data:

Annotations for 1639337_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime