FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639338_at:

>probe:Drosophila_2:1639338_at:63:235; Interrogation_Position=331; Antisense; AATGCCCAGTACGTGATCCACGAGA
>probe:Drosophila_2:1639338_at:305:515; Interrogation_Position=370; Antisense; GTGGGACCCAACGACATCGGCCTAA
>probe:Drosophila_2:1639338_at:108:39; Interrogation_Position=385; Antisense; ATCGGCCTAATTCTCCTCAAGGAAG
>probe:Drosophila_2:1639338_at:705:447; Interrogation_Position=412; Antisense; GATGCCTTTGACCTGAATGCCGTTG
>probe:Drosophila_2:1639338_at:623:605; Interrogation_Position=441; Antisense; TGATGGCAGCAATCCGGTTTCCGCA
>probe:Drosophila_2:1639338_at:200:719; Interrogation_Position=459; Antisense; TTCCGCAGTAAGTCTTCCTTCAAAG
>probe:Drosophila_2:1639338_at:623:577; Interrogation_Position=523; Antisense; GGCCGCGACAACTCAGGATTGCTGC
>probe:Drosophila_2:1639338_at:230:465; Interrogation_Position=539; Antisense; GATTGCTGCCGCTGAACCTTCAGAA
>probe:Drosophila_2:1639338_at:365:195; Interrogation_Position=563; Antisense; AACTGGACGCTATCATTGTTGACTA
>probe:Drosophila_2:1639338_at:696:181; Interrogation_Position=660; Antisense; AAAAGCCGACGGATCCTGCAACGGA
>probe:Drosophila_2:1639338_at:378:537; Interrogation_Position=702; Antisense; GGTCTCGCAATCCAGCAGTCGAGGA
>probe:Drosophila_2:1639338_at:90:545; Interrogation_Position=754; Antisense; GGATACACACCCTGTTTGTCCACAA
>probe:Drosophila_2:1639338_at:594:683; Interrogation_Position=781; Antisense; TATCCTTCCGTATACACATCAGTGT
>probe:Drosophila_2:1639338_at:477:151; Interrogation_Position=796; Antisense; ACATCAGTGTCTTCGTTTTTGCCTT

Paste this into a BLAST search page for me
AATGCCCAGTACGTGATCCACGAGAGTGGGACCCAACGACATCGGCCTAAATCGGCCTAATTCTCCTCAAGGAAGGATGCCTTTGACCTGAATGCCGTTGTGATGGCAGCAATCCGGTTTCCGCATTCCGCAGTAAGTCTTCCTTCAAAGGGCCGCGACAACTCAGGATTGCTGCGATTGCTGCCGCTGAACCTTCAGAAAACTGGACGCTATCATTGTTGACTAAAAAGCCGACGGATCCTGCAACGGAGGTCTCGCAATCCAGCAGTCGAGGAGGATACACACCCTGTTTGTCCACAATATCCTTCCGTATACACATCAGTGTACATCAGTGTCTTCGTTTTTGCCTT

Full Affymetrix probeset data:

Annotations for 1639338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720