Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639341_at:

>probe:Drosophila_2:1639341_at:369:343; Interrogation_Position=1882; Antisense; GCATTCCCGCCTTGTGCATTTAGGG
>probe:Drosophila_2:1639341_at:520:317; Interrogation_Position=1907; Antisense; GCTAGGCTAGATATATGAGACGTAC
>probe:Drosophila_2:1639341_at:107:93; Interrogation_Position=1968; Antisense; AGTTGATTCGATTGTAACGACACGA
>probe:Drosophila_2:1639341_at:531:235; Interrogation_Position=2054; Antisense; AATCTTTTTGCATTTGTGAAGCTGA
>probe:Drosophila_2:1639341_at:443:505; Interrogation_Position=2095; Antisense; GTCCAAAGTTTGCTTGAGTTCCGAA
>probe:Drosophila_2:1639341_at:571:399; Interrogation_Position=2110; Antisense; GAGTTCCGAAATCTATCTCGTTTCT
>probe:Drosophila_2:1639341_at:337:281; Interrogation_Position=2147; Antisense; CTCGATCTTAAGTCATACAACCTAT
>probe:Drosophila_2:1639341_at:223:173; Interrogation_Position=2183; Antisense; AAAGCCTTAATGACCCTTTCATTGT
>probe:Drosophila_2:1639341_at:396:645; Interrogation_Position=2201; Antisense; TCATTGTTCCTTAACTGACATCTTT
>probe:Drosophila_2:1639341_at:18:613; Interrogation_Position=2216; Antisense; TGACATCTTTAATTTGGCATTCCAA
>probe:Drosophila_2:1639341_at:31:655; Interrogation_Position=2276; Antisense; TAATTTGAAAGCTCCCGCAAACGTC
>probe:Drosophila_2:1639341_at:203:337; Interrogation_Position=2286; Antisense; GCTCCCGCAAACGTCTGATTAAATT
>probe:Drosophila_2:1639341_at:455:525; Interrogation_Position=2318; Antisense; GGGCATTGTTCTTTAGCGAATTATA
>probe:Drosophila_2:1639341_at:388:599; Interrogation_Position=2348; Antisense; TGTCTTCGTTGTTTTTAGTTAATGC

Paste this into a BLAST search page for me
GCATTCCCGCCTTGTGCATTTAGGGGCTAGGCTAGATATATGAGACGTACAGTTGATTCGATTGTAACGACACGAAATCTTTTTGCATTTGTGAAGCTGAGTCCAAAGTTTGCTTGAGTTCCGAAGAGTTCCGAAATCTATCTCGTTTCTCTCGATCTTAAGTCATACAACCTATAAAGCCTTAATGACCCTTTCATTGTTCATTGTTCCTTAACTGACATCTTTTGACATCTTTAATTTGGCATTCCAATAATTTGAAAGCTCCCGCAAACGTCGCTCCCGCAAACGTCTGATTAAATTGGGCATTGTTCTTTAGCGAATTATATGTCTTCGTTGTTTTTAGTTAATGC

Full Affymetrix probeset data:

Annotations for 1639341_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime