FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639342_at:

>probe:Drosophila_2:1639342_at:613:275; Interrogation_Position=18; Antisense; CTTCAAGTTCTTCGCTGTTCTCGCC
>probe:Drosophila_2:1639342_at:267:649; Interrogation_Position=246; Antisense; TCAGGTTGAGGAGCGTGATGGCGAC
>probe:Drosophila_2:1639342_at:200:583; Interrogation_Position=264; Antisense; TGGCGACGTGGTCCATGGCGAGTAC
>probe:Drosophila_2:1639342_at:286:583; Interrogation_Position=306; Antisense; TGGCTACAAGCGCATTGTCCAGTAC
>probe:Drosophila_2:1639342_at:529:663; Interrogation_Position=310; Antisense; TACAAGCGCATTGTCCAGTACACCT
>probe:Drosophila_2:1639342_at:241:121; Interrogation_Position=314; Antisense; AGCGCATTGTCCAGTACACCTCCGA
>probe:Drosophila_2:1639342_at:316:477; Interrogation_Position=350; Antisense; GTTTCAACGCCGTCGTCAACCGCGT
>probe:Drosophila_2:1639342_at:66:297; Interrogation_Position=370; Antisense; CGCGTTCCCCTGGATCACGTGAAGA
>probe:Drosophila_2:1639342_at:580:717; Interrogation_Position=374; Antisense; TTCCCCTGGATCACGTGAAGACCGT
>probe:Drosophila_2:1639342_at:301:35; Interrogation_Position=383; Antisense; ATCACGTGAAGACCGTGGTGAAGAC
>probe:Drosophila_2:1639342_at:163:613; Interrogation_Position=401; Antisense; TGAAGACCGTGGCTCCTGTGGCCGT
>probe:Drosophila_2:1639342_at:428:595; Interrogation_Position=417; Antisense; TGTGGCCGTGGCTGCTGCCCCTATC
>probe:Drosophila_2:1639342_at:725:37; Interrogation_Position=46; Antisense; ATCTCGGCCGCCAGTGCCGGAGTTC
>probe:Drosophila_2:1639342_at:627:625; Interrogation_Position=60; Antisense; TGCCGGAGTTCTTCCCGTCCAGCAG

Paste this into a BLAST search page for me
CTTCAAGTTCTTCGCTGTTCTCGCCTCAGGTTGAGGAGCGTGATGGCGACTGGCGACGTGGTCCATGGCGAGTACTGGCTACAAGCGCATTGTCCAGTACTACAAGCGCATTGTCCAGTACACCTAGCGCATTGTCCAGTACACCTCCGAGTTTCAACGCCGTCGTCAACCGCGTCGCGTTCCCCTGGATCACGTGAAGATTCCCCTGGATCACGTGAAGACCGTATCACGTGAAGACCGTGGTGAAGACTGAAGACCGTGGCTCCTGTGGCCGTTGTGGCCGTGGCTGCTGCCCCTATCATCTCGGCCGCCAGTGCCGGAGTTCTGCCGGAGTTCTTCCCGTCCAGCAG

Full Affymetrix probeset data:

Annotations for 1639342_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720