FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639343_at:

>probe:Drosophila_2:1639343_at:173:507; Interrogation_Position=1005; Antisense; GTGCCCCTGCCATTAATCATATTAA
>probe:Drosophila_2:1639343_at:513:351; Interrogation_Position=1057; Antisense; GCAGAATGGTGTAGCCTCTTCAGCG
>probe:Drosophila_2:1639343_at:617:647; Interrogation_Position=1076; Antisense; TCAGCGCCGGCTTTGCGTTATGTAA
>probe:Drosophila_2:1639343_at:632:15; Interrogation_Position=1169; Antisense; ATTATGCTGCACACTGGCCTTGTTT
>probe:Drosophila_2:1639343_at:692:477; Interrogation_Position=1190; Antisense; GTTTCAGAGCTACCGTTACGCAACA
>probe:Drosophila_2:1639343_at:458:329; Interrogation_Position=1252; Antisense; GCGGATCCTAGCTGTAAACTTCAAT
>probe:Drosophila_2:1639343_at:304:73; Interrogation_Position=1331; Antisense; AGGAAACTACGCGTGCCAGACAAAT
>probe:Drosophila_2:1639343_at:556:323; Interrogation_Position=1358; Antisense; GCGGCCATACCTAAGTTGGTCCTAA
>probe:Drosophila_2:1639343_at:718:333; Interrogation_Position=808; Antisense; GCTGAAGCACACTTGGTCCTTTCAA
>probe:Drosophila_2:1639343_at:722:291; Interrogation_Position=842; Antisense; CGTCGTTACTTTCGGCTCAAGCGGA
>probe:Drosophila_2:1639343_at:482:241; Interrogation_Position=866; Antisense; AATATGCTGTTCTACGCCAAGGATG
>probe:Drosophila_2:1639343_at:664:239; Interrogation_Position=953; Antisense; AATAAATTGAACCTCGTCTCGCCTG
>probe:Drosophila_2:1639343_at:532:497; Interrogation_Position=968; Antisense; GTCTCGCCTGTCAATGTCAATTCAA
>probe:Drosophila_2:1639343_at:665:245; Interrogation_Position=986; Antisense; AATTCAACTCGATTGCGGTGTGCCC

Paste this into a BLAST search page for me
GTGCCCCTGCCATTAATCATATTAAGCAGAATGGTGTAGCCTCTTCAGCGTCAGCGCCGGCTTTGCGTTATGTAAATTATGCTGCACACTGGCCTTGTTTGTTTCAGAGCTACCGTTACGCAACAGCGGATCCTAGCTGTAAACTTCAATAGGAAACTACGCGTGCCAGACAAATGCGGCCATACCTAAGTTGGTCCTAAGCTGAAGCACACTTGGTCCTTTCAACGTCGTTACTTTCGGCTCAAGCGGAAATATGCTGTTCTACGCCAAGGATGAATAAATTGAACCTCGTCTCGCCTGGTCTCGCCTGTCAATGTCAATTCAAAATTCAACTCGATTGCGGTGTGCCC

Full Affymetrix probeset data:

Annotations for 1639343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720