Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639344_at:

>probe:Drosophila_2:1639344_at:235:13; Interrogation_Position=1305; Antisense; ATTACTAGCCAAGTGTCCGGATCAA
>probe:Drosophila_2:1639344_at:715:109; Interrogation_Position=1338; Antisense; AGAATCTCTCTTTATGTACAACATA
>probe:Drosophila_2:1639344_at:348:491; Interrogation_Position=1353; Antisense; GTACAACATATCCTTTCATCTGACT
>probe:Drosophila_2:1639344_at:18:163; Interrogation_Position=1416; Antisense; AAATACCCCATATACTTTTCAATTG
>probe:Drosophila_2:1639344_at:659:451; Interrogation_Position=1523; Antisense; GATCTAACCTATCCTTAACCATAAT
>probe:Drosophila_2:1639344_at:604:485; Interrogation_Position=1550; Antisense; GTAGGCATGTGCAACTGAGTGAAAT
>probe:Drosophila_2:1639344_at:555:527; Interrogation_Position=1578; Antisense; GGGAAACTGCCAAACGGATCAGCGA
>probe:Drosophila_2:1639344_at:119:679; Interrogation_Position=1610; Antisense; TAGTTTGGGCAGCAACTTCACTGGC
>probe:Drosophila_2:1639344_at:227:149; Interrogation_Position=1624; Antisense; ACTTCACTGGCCAAAACATTTCCCA
>probe:Drosophila_2:1639344_at:132:589; Interrogation_Position=1669; Antisense; TGGTCAACGGGTGGCGATGTCCCCA
>probe:Drosophila_2:1639344_at:619:575; Interrogation_Position=1681; Antisense; GGCGATGTCCCCAAAAGTACGATAT
>probe:Drosophila_2:1639344_at:676:217; Interrogation_Position=1735; Antisense; AAGTCCATTCGACCCTATCATTTGA
>probe:Drosophila_2:1639344_at:617:449; Interrogation_Position=1769; Antisense; GTAGGGTCCTTATGCTAACGGCCAA
>probe:Drosophila_2:1639344_at:132:525; Interrogation_Position=1833; Antisense; GGGCATTACGTTTATCGCCAGGATG

Paste this into a BLAST search page for me
ATTACTAGCCAAGTGTCCGGATCAAAGAATCTCTCTTTATGTACAACATAGTACAACATATCCTTTCATCTGACTAAATACCCCATATACTTTTCAATTGGATCTAACCTATCCTTAACCATAATGTAGGCATGTGCAACTGAGTGAAATGGGAAACTGCCAAACGGATCAGCGATAGTTTGGGCAGCAACTTCACTGGCACTTCACTGGCCAAAACATTTCCCATGGTCAACGGGTGGCGATGTCCCCAGGCGATGTCCCCAAAAGTACGATATAAGTCCATTCGACCCTATCATTTGAGTAGGGTCCTTATGCTAACGGCCAAGGGCATTACGTTTATCGCCAGGATG

Full Affymetrix probeset data:

Annotations for 1639344_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime