Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639346_at:

>probe:Drosophila_2:1639346_at:202:291; Interrogation_Position=1483; Antisense; CGGTTCTATAGCTCTGTCTATCATA
>probe:Drosophila_2:1639346_at:205:119; Interrogation_Position=1492; Antisense; AGCTCTGTCTATCATATTGGCTACA
>probe:Drosophila_2:1639346_at:297:21; Interrogation_Position=1505; Antisense; ATATTGGCTACATCAGTTGGGCGGC
>probe:Drosophila_2:1639346_at:508:339; Interrogation_Position=1511; Antisense; GCTACATCAGTTGGGCGGCCATGAC
>probe:Drosophila_2:1639346_at:624:305; Interrogation_Position=1529; Antisense; CCATGACTGCGTTAGGCTTTTACCT
>probe:Drosophila_2:1639346_at:144:343; Interrogation_Position=1544; Antisense; GCTTTTACCTCACCAGCCAGAGAAA
>probe:Drosophila_2:1639346_at:19:367; Interrogation_Position=1622; Antisense; GAATCGCCGCCGCAATAGAGAAGGA
>probe:Drosophila_2:1639346_at:47:371; Interrogation_Position=1647; Antisense; GAAGGCGCAGTAGAGTGTCCAGTTT
>probe:Drosophila_2:1639346_at:177:101; Interrogation_Position=1658; Antisense; AGAGTGTCCAGTTTGTTGCTACCAA
>probe:Drosophila_2:1639346_at:477:591; Interrogation_Position=1684; Antisense; TGGGTAGTTTCCATTCAAAACACAA
>probe:Drosophila_2:1639346_at:673:363; Interrogation_Position=1793; Antisense; GAATTTCTTCTTAGAGATGTTCTTC
>probe:Drosophila_2:1639346_at:565:471; Interrogation_Position=1811; Antisense; GTTCTTCTCTACATAAGTCACCATT
>probe:Drosophila_2:1639346_at:406:255; Interrogation_Position=1847; Antisense; CAAAGTGGTCTTGTTACGCCTTCTA
>probe:Drosophila_2:1639346_at:673:687; Interrogation_Position=1979; Antisense; TATATTTTAACCAAAGCCTGTGAAA

Paste this into a BLAST search page for me
CGGTTCTATAGCTCTGTCTATCATAAGCTCTGTCTATCATATTGGCTACAATATTGGCTACATCAGTTGGGCGGCGCTACATCAGTTGGGCGGCCATGACCCATGACTGCGTTAGGCTTTTACCTGCTTTTACCTCACCAGCCAGAGAAAGAATCGCCGCCGCAATAGAGAAGGAGAAGGCGCAGTAGAGTGTCCAGTTTAGAGTGTCCAGTTTGTTGCTACCAATGGGTAGTTTCCATTCAAAACACAAGAATTTCTTCTTAGAGATGTTCTTCGTTCTTCTCTACATAAGTCACCATTCAAAGTGGTCTTGTTACGCCTTCTATATATTTTAACCAAAGCCTGTGAAA

Full Affymetrix probeset data:

Annotations for 1639346_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime