FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639348_at:

>probe:Drosophila_2:1639348_at:276:143; Interrogation_Position=118; Antisense; ACTGGCATCATTTCCCACTTTGTGA
>probe:Drosophila_2:1639348_at:299:511; Interrogation_Position=139; Antisense; GTGAATCTTCAAGTGGTTGTTCCAG
>probe:Drosophila_2:1639348_at:444:99; Interrogation_Position=162; Antisense; AGAGGCATTCATTCTGGGCTCCGGC
>probe:Drosophila_2:1639348_at:595:501; Interrogation_Position=196; Antisense; GTCGACATGGGCTCAACAATCAATT
>probe:Drosophila_2:1639348_at:396:5; Interrogation_Position=232; Antisense; ATTGAGAAGAGTCCTACACCACCGC
>probe:Drosophila_2:1639348_at:609:449; Interrogation_Position=280; Antisense; GATCGCCTGATCAACTACGTCGACT
>probe:Drosophila_2:1639348_at:564:395; Interrogation_Position=313; Antisense; GACATAACCATTGAGACGACCCCGG
>probe:Drosophila_2:1639348_at:102:553; Interrogation_Position=420; Antisense; GGAGCCGGCGAGCATATACGTCTTC
>probe:Drosophila_2:1639348_at:716:667; Interrogation_Position=436; Antisense; TACGTCTTCGTTTCGAAAGGCGACA
>probe:Drosophila_2:1639348_at:161:25; Interrogation_Position=461; Antisense; ATATGGCGGCAATCTCGCGGCGGAA
>probe:Drosophila_2:1639348_at:9:451; Interrogation_Position=499; Antisense; GATCGCCTGACGCACATATTTAGGT
>probe:Drosophila_2:1639348_at:569:21; Interrogation_Position=514; Antisense; ATATTTAGGTCGATGCTGGCGCCCT
>probe:Drosophila_2:1639348_at:244:599; Interrogation_Position=538; Antisense; TGTCTCCTGCTGAACACGGTTGTTG
>probe:Drosophila_2:1639348_at:346:553; Interrogation_Position=70; Antisense; GGACCATCCGCCATAAAATCAAACA

Paste this into a BLAST search page for me
ACTGGCATCATTTCCCACTTTGTGAGTGAATCTTCAAGTGGTTGTTCCAGAGAGGCATTCATTCTGGGCTCCGGCGTCGACATGGGCTCAACAATCAATTATTGAGAAGAGTCCTACACCACCGCGATCGCCTGATCAACTACGTCGACTGACATAACCATTGAGACGACCCCGGGGAGCCGGCGAGCATATACGTCTTCTACGTCTTCGTTTCGAAAGGCGACAATATGGCGGCAATCTCGCGGCGGAAGATCGCCTGACGCACATATTTAGGTATATTTAGGTCGATGCTGGCGCCCTTGTCTCCTGCTGAACACGGTTGTTGGGACCATCCGCCATAAAATCAAACA

Full Affymetrix probeset data:

Annotations for 1639348_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720