FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639350_at:

>probe:Drosophila_2:1639350_at:151:517; Interrogation_Position=1010; Antisense; GTGTCCACTAACTAACGAGACGCGA
>probe:Drosophila_2:1639350_at:206:415; Interrogation_Position=1033; Antisense; GACCAAGCCCAAAACGATCATCGTT
>probe:Drosophila_2:1639350_at:34:137; Interrogation_Position=1046; Antisense; ACGATCATCGTTTGCGTACACTGCA
>probe:Drosophila_2:1639350_at:317:201; Interrogation_Position=647; Antisense; AAGCGTGAAAAGTGCCCAAGGTCGA
>probe:Drosophila_2:1639350_at:48:121; Interrogation_Position=686; Antisense; AGCGGAACTCTAACTGGGCAAAAAG
>probe:Drosophila_2:1639350_at:372:163; Interrogation_Position=748; Antisense; AAATCTACGTGCCTACAAATCCTGC
>probe:Drosophila_2:1639350_at:10:355; Interrogation_Position=773; Antisense; GCACTTACAGCGAGCGGATTTTCAC
>probe:Drosophila_2:1639350_at:388:461; Interrogation_Position=789; Antisense; GATTTTCACTGATATCCTCTGGGTC
>probe:Drosophila_2:1639350_at:548:23; Interrogation_Position=800; Antisense; ATATCCTCTGGGTCCGCAATCTTGG
>probe:Drosophila_2:1639350_at:231:363; Interrogation_Position=815; Antisense; GCAATCTTGGCCAATTCGGAACACA
>probe:Drosophila_2:1639350_at:128:399; Interrogation_Position=893; Antisense; GACACGCGACCAATGGGACTCTTTT
>probe:Drosophila_2:1639350_at:315:317; Interrogation_Position=947; Antisense; GCCGACACTTTTTGTACTGCGTTGT
>probe:Drosophila_2:1639350_at:346:667; Interrogation_Position=961; Antisense; TACTGCGTTGTCTGCAGCGATCTGC
>probe:Drosophila_2:1639350_at:388:39; Interrogation_Position=980; Antisense; ATCTGCGCCTGTGATCAGTCACATA

Paste this into a BLAST search page for me
GTGTCCACTAACTAACGAGACGCGAGACCAAGCCCAAAACGATCATCGTTACGATCATCGTTTGCGTACACTGCAAAGCGTGAAAAGTGCCCAAGGTCGAAGCGGAACTCTAACTGGGCAAAAAGAAATCTACGTGCCTACAAATCCTGCGCACTTACAGCGAGCGGATTTTCACGATTTTCACTGATATCCTCTGGGTCATATCCTCTGGGTCCGCAATCTTGGGCAATCTTGGCCAATTCGGAACACAGACACGCGACCAATGGGACTCTTTTGCCGACACTTTTTGTACTGCGTTGTTACTGCGTTGTCTGCAGCGATCTGCATCTGCGCCTGTGATCAGTCACATA

Full Affymetrix probeset data:

Annotations for 1639350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720