FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639351_at:

>probe:Drosophila_2:1639351_at:346:3; Interrogation_Position=480; Antisense; ATTGGGACCCAACGAATTGGACGAT
>probe:Drosophila_2:1639351_at:138:437; Interrogation_Position=502; Antisense; GATGGCCAGTATCGTGAGGACCCCT
>probe:Drosophila_2:1639351_at:246:433; Interrogation_Position=517; Antisense; GAGGACCCCTCGGTGTACTACAAGG
>probe:Drosophila_2:1639351_at:421:157; Interrogation_Position=536; Antisense; ACAAGGACCAGAAGTTCAATCGCCC
>probe:Drosophila_2:1639351_at:252:697; Interrogation_Position=563; Antisense; TTTCACCGGCCAGTAAATTCAGTCT
>probe:Drosophila_2:1639351_at:665:239; Interrogation_Position=578; Antisense; AATTCAGTCTGAACGATTTCGGCCG
>probe:Drosophila_2:1639351_at:148:619; Interrogation_Position=794; Antisense; TGCGAAATCTCAACCTCTACACCGG
>probe:Drosophila_2:1639351_at:238:643; Interrogation_Position=809; Antisense; TCTACACCGGTTCCTATAGCATCGA
>probe:Drosophila_2:1639351_at:53:675; Interrogation_Position=825; Antisense; TAGCATCGACTATACGGGCCGGAAG
>probe:Drosophila_2:1639351_at:385:529; Interrogation_Position=874; Antisense; GGGATCACCTCTGAGTTGGGCCAGA
>probe:Drosophila_2:1639351_at:481:397; Interrogation_Position=923; Antisense; GACAATGTCAACTTGTTACTGCCAA
>probe:Drosophila_2:1639351_at:691:309; Interrogation_Position=943; Antisense; GCCAAATAAATCAGTCACTCCGCAC
>probe:Drosophila_2:1639351_at:511:155; Interrogation_Position=966; Antisense; ACACCCCACACATGTATCTATTACT
>probe:Drosophila_2:1639351_at:244:487; Interrogation_Position=991; Antisense; GTACCTGTTTATATATGTTCTTGAA

Paste this into a BLAST search page for me
ATTGGGACCCAACGAATTGGACGATGATGGCCAGTATCGTGAGGACCCCTGAGGACCCCTCGGTGTACTACAAGGACAAGGACCAGAAGTTCAATCGCCCTTTCACCGGCCAGTAAATTCAGTCTAATTCAGTCTGAACGATTTCGGCCGTGCGAAATCTCAACCTCTACACCGGTCTACACCGGTTCCTATAGCATCGATAGCATCGACTATACGGGCCGGAAGGGGATCACCTCTGAGTTGGGCCAGAGACAATGTCAACTTGTTACTGCCAAGCCAAATAAATCAGTCACTCCGCACACACCCCACACATGTATCTATTACTGTACCTGTTTATATATGTTCTTGAA

Full Affymetrix probeset data:

Annotations for 1639351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720