FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639353_at:

>probe:Drosophila_2:1639353_at:133:91; Interrogation_Position=1010; Antisense; AGTTAAATCCGCTGGGACCACTCGG
>probe:Drosophila_2:1639353_at:453:539; Interrogation_Position=1042; Antisense; GGTTACAACCAGGAGCAGGCCGCAT
>probe:Drosophila_2:1639353_at:719:227; Interrogation_Position=1096; Antisense; AATGGACTCAACTCAGGATCCTCGG
>probe:Drosophila_2:1639353_at:27:345; Interrogation_Position=1142; Antisense; GCTTCCAGTCGCAGAGTGCCAATGG
>probe:Drosophila_2:1639353_at:372:505; Interrogation_Position=1157; Antisense; GTGCCAATGGATCATTCGGTGCCTC
>probe:Drosophila_2:1639353_at:167:129; Interrogation_Position=1213; Antisense; ACCAGCCCCTTTGGATCCAATAATG
>probe:Drosophila_2:1639353_at:370:233; Interrogation_Position=1234; Antisense; AATGCGGCAGGTGCTTCGCTGAGTC
>probe:Drosophila_2:1639353_at:92:609; Interrogation_Position=1253; Antisense; TGAGTCAGGTTTACCATCTTCCCAA
>probe:Drosophila_2:1639353_at:269:675; Interrogation_Position=1296; Antisense; TAGCTCCACGAACAGCTTCGCTAAT
>probe:Drosophila_2:1639353_at:644:567; Interrogation_Position=1353; Antisense; GGCAGTTTCTGTCAGCCGCTAAAAG
>probe:Drosophila_2:1639353_at:190:319; Interrogation_Position=1367; Antisense; GCCGCTAAAAGCCAAGTTCACCATA
>probe:Drosophila_2:1639353_at:82:393; Interrogation_Position=881; Antisense; GAAATCCCGGATTCGGCGGTAATCA
>probe:Drosophila_2:1639353_at:350:93; Interrogation_Position=915; Antisense; AGTTCAGGCAGGTACATCGGCCGGC
>probe:Drosophila_2:1639353_at:285:49; Interrogation_Position=992; Antisense; ATGCCAATGCCAACGTCGAGTTAAA

Paste this into a BLAST search page for me
AGTTAAATCCGCTGGGACCACTCGGGGTTACAACCAGGAGCAGGCCGCATAATGGACTCAACTCAGGATCCTCGGGCTTCCAGTCGCAGAGTGCCAATGGGTGCCAATGGATCATTCGGTGCCTCACCAGCCCCTTTGGATCCAATAATGAATGCGGCAGGTGCTTCGCTGAGTCTGAGTCAGGTTTACCATCTTCCCAATAGCTCCACGAACAGCTTCGCTAATGGCAGTTTCTGTCAGCCGCTAAAAGGCCGCTAAAAGCCAAGTTCACCATAGAAATCCCGGATTCGGCGGTAATCAAGTTCAGGCAGGTACATCGGCCGGCATGCCAATGCCAACGTCGAGTTAAA

Full Affymetrix probeset data:

Annotations for 1639353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720