Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639354_at:

>probe:Drosophila_2:1639354_at:222:419; Interrogation_Position=1001; Antisense; GAGCTGAAACGCCACATGCGCAAGC
>probe:Drosophila_2:1639354_at:23:421; Interrogation_Position=1032; Antisense; GAGAGCGACCGTTTGCATGTAAGTA
>probe:Drosophila_2:1639354_at:602:59; Interrogation_Position=1048; Antisense; ATGTAAGTACTGTGGCCGCTGCTTC
>probe:Drosophila_2:1639354_at:179:615; Interrogation_Position=1092; Antisense; TGAAGCATGAGCGTACCCACACCAA
>probe:Drosophila_2:1639354_at:126:279; Interrogation_Position=1126; Antisense; CTACGTCTGTGGTACTTGCGGCAAG
>probe:Drosophila_2:1639354_at:262:667; Interrogation_Position=1159; Antisense; TACCGGCTACATCCTTAAGAACCAT
>probe:Drosophila_2:1639354_at:408:683; Interrogation_Position=1183; Antisense; TATGCTGATACATTCCGGCGAGCGG
>probe:Drosophila_2:1639354_at:84:537; Interrogation_Position=1272; Antisense; GGTCTGGCGTACACAAGCGGCATCT
>probe:Drosophila_2:1639354_at:369:203; Interrogation_Position=1302; Antisense; AAGCCGAGATGAAACAGGTCCTGGA
>probe:Drosophila_2:1639354_at:206:437; Interrogation_Position=1361; Antisense; GAGGACAGCCTGCACATCTAAAGCT
>probe:Drosophila_2:1639354_at:172:667; Interrogation_Position=1411; Antisense; TACAGGCAATGCTAGACCGACAATG
>probe:Drosophila_2:1639354_at:143:355; Interrogation_Position=1438; Antisense; GCACAGCCAAGGAGCATTTCTGCAA
>probe:Drosophila_2:1639354_at:698:243; Interrogation_Position=957; Antisense; AATTTGGCTGCGAACTCTGTCAGTC
>probe:Drosophila_2:1639354_at:71:715; Interrogation_Position=986; Antisense; TTCTGCACAACTTCCGAGCTGAAAC

Paste this into a BLAST search page for me
GAGCTGAAACGCCACATGCGCAAGCGAGAGCGACCGTTTGCATGTAAGTAATGTAAGTACTGTGGCCGCTGCTTCTGAAGCATGAGCGTACCCACACCAACTACGTCTGTGGTACTTGCGGCAAGTACCGGCTACATCCTTAAGAACCATTATGCTGATACATTCCGGCGAGCGGGGTCTGGCGTACACAAGCGGCATCTAAGCCGAGATGAAACAGGTCCTGGAGAGGACAGCCTGCACATCTAAAGCTTACAGGCAATGCTAGACCGACAATGGCACAGCCAAGGAGCATTTCTGCAAAATTTGGCTGCGAACTCTGTCAGTCTTCTGCACAACTTCCGAGCTGAAAC

Full Affymetrix probeset data:

Annotations for 1639354_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime