FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639357_at:

>probe:Drosophila_2:1639357_at:322:143; Interrogation_Position=138; Antisense; ACTTCGTGACCCTGGAAACGAGCAT
>probe:Drosophila_2:1639357_at:169:395; Interrogation_Position=167; Antisense; GAAATCACCGTGGAGCTGTACTGGA
>probe:Drosophila_2:1639357_at:581:117; Interrogation_Position=180; Antisense; AGCTGTACTGGAAACACGCGCCCAA
>probe:Drosophila_2:1639357_at:571:359; Interrogation_Position=213; Antisense; GCAACTTTGCCGAACTCTCGAGAAG
>probe:Drosophila_2:1639357_at:191:519; Interrogation_Position=238; Antisense; GGGCTACTACAACAACGTGGTGTTC
>probe:Drosophila_2:1639357_at:468:531; Interrogation_Position=256; Antisense; GGTGTTCCACCGGATCATCAGGGAC
>probe:Drosophila_2:1639357_at:200:37; Interrogation_Position=332; Antisense; ATCTACGGATCGGAGTTCGCGGACG
>probe:Drosophila_2:1639357_at:269:419; Interrogation_Position=356; Antisense; GAGCTGCACGGCGACTTGAGGCACA
>probe:Drosophila_2:1639357_at:479:637; Interrogation_Position=398; Antisense; TCGATGGCCAACTCTGGACCGGACA
>probe:Drosophila_2:1639357_at:531:309; Interrogation_Position=456; Antisense; CCACGCAGTGGCTGGATGGCAAGCA
>probe:Drosophila_2:1639357_at:14:441; Interrogation_Position=470; Antisense; GATGGCAAGCACACGATCTTCGGCA
>probe:Drosophila_2:1639357_at:624:37; Interrogation_Position=485; Antisense; ATCTTCGGCAGGGTCTACACGGGCA
>probe:Drosophila_2:1639357_at:415:295; Interrogation_Position=544; Antisense; CGACAAGAACGATCGCCCCGTGGAT
>probe:Drosophila_2:1639357_at:524:43; Interrogation_Position=567; Antisense; ATCCCCTAAGGATCATCAAGGCCAA

Paste this into a BLAST search page for me
ACTTCGTGACCCTGGAAACGAGCATGAAATCACCGTGGAGCTGTACTGGAAGCTGTACTGGAAACACGCGCCCAAGCAACTTTGCCGAACTCTCGAGAAGGGGCTACTACAACAACGTGGTGTTCGGTGTTCCACCGGATCATCAGGGACATCTACGGATCGGAGTTCGCGGACGGAGCTGCACGGCGACTTGAGGCACATCGATGGCCAACTCTGGACCGGACACCACGCAGTGGCTGGATGGCAAGCAGATGGCAAGCACACGATCTTCGGCAATCTTCGGCAGGGTCTACACGGGCACGACAAGAACGATCGCCCCGTGGATATCCCCTAAGGATCATCAAGGCCAA

Full Affymetrix probeset data:

Annotations for 1639357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720