FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639358_at:

>probe:Drosophila_2:1639358_at:222:85; Interrogation_Position=1021; Antisense; AGTGCATCCGGACGTCTATGTGCAT
>probe:Drosophila_2:1639358_at:608:3; Interrogation_Position=1112; Antisense; ATTGGACCAGGTGTGCGCATTCGCG
>probe:Drosophila_2:1639358_at:150:421; Interrogation_Position=1151; Antisense; GAGCAGGCACAGATCCTGGACCATA
>probe:Drosophila_2:1639358_at:715:279; Interrogation_Position=1178; Antisense; CTCGTGCTGCACTCTATTGTGGGCA
>probe:Drosophila_2:1639358_at:137:431; Interrogation_Position=1230; Antisense; GAGTCGAGGGCACACCTAGTGATCC
>probe:Drosophila_2:1639358_at:76:257; Interrogation_Position=1290; Antisense; CACCGCTTTTCAACAACGAGGGCAA
>probe:Drosophila_2:1639358_at:53:129; Interrogation_Position=1331; Antisense; ACCATACTGGGCTGTTTCGTGCAGG
>probe:Drosophila_2:1639358_at:600:625; Interrogation_Position=1356; Antisense; TGCCCGCCGAGAAAATCCTGCTGAA
>probe:Drosophila_2:1639358_at:465:613; Interrogation_Position=1377; Antisense; TGAACAGCATTGTACTGCCGCACAA
>probe:Drosophila_2:1639358_at:721:159; Interrogation_Position=1398; Antisense; ACAAGGAGCTCAGTCGCAGCTTCAA
>probe:Drosophila_2:1639358_at:521:689; Interrogation_Position=1451; Antisense; TATTTTTTATCTTCGCTCTGTGTCC
>probe:Drosophila_2:1639358_at:213:517; Interrogation_Position=1470; Antisense; GTGTCCCTATCAGTATGTCATTTTA
>probe:Drosophila_2:1639358_at:457:709; Interrogation_Position=1532; Antisense; TTAAATGTGTCTTATCCTCTGCAGC
>probe:Drosophila_2:1639358_at:630:527; Interrogation_Position=999; Antisense; GGGACGGCAGCTTGATCTGCACAGT

Paste this into a BLAST search page for me
AGTGCATCCGGACGTCTATGTGCATATTGGACCAGGTGTGCGCATTCGCGGAGCAGGCACAGATCCTGGACCATACTCGTGCTGCACTCTATTGTGGGCAGAGTCGAGGGCACACCTAGTGATCCCACCGCTTTTCAACAACGAGGGCAAACCATACTGGGCTGTTTCGTGCAGGTGCCCGCCGAGAAAATCCTGCTGAATGAACAGCATTGTACTGCCGCACAAACAAGGAGCTCAGTCGCAGCTTCAATATTTTTTATCTTCGCTCTGTGTCCGTGTCCCTATCAGTATGTCATTTTATTAAATGTGTCTTATCCTCTGCAGCGGGACGGCAGCTTGATCTGCACAGT

Full Affymetrix probeset data:

Annotations for 1639358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720