FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639359_at:

>probe:Drosophila_2:1639359_at:40:559; Interrogation_Position=1155; Antisense; GGACATTTTCCAGGCTTTTCAAGCT
>probe:Drosophila_2:1639359_at:75:111; Interrogation_Position=1180; Antisense; AGCAACGATGTGGACGACGGCCCAT
>probe:Drosophila_2:1639359_at:488:639; Interrogation_Position=1214; Antisense; TCGTGCACGGAGACCTGTGGATCAA
>probe:Drosophila_2:1639359_at:444:563; Interrogation_Position=1272; Antisense; GGAAGGCACTCCACTCAAGGTGAAA
>probe:Drosophila_2:1639359_at:280:725; Interrogation_Position=1301; Antisense; TTGACTTTCAAATCGCGCAGTACGG
>probe:Drosophila_2:1639359_at:92:459; Interrogation_Position=1339; Antisense; GATATCATCTTTGTGCTGTTCTCAA
>probe:Drosophila_2:1639359_at:32:507; Interrogation_Position=1351; Antisense; GTGCTGTTCTCAAGTGTGGACGTAA
>probe:Drosophila_2:1639359_at:314:701; Interrogation_Position=1413; Antisense; TTATTACAACGCCTTCATTCAGACC
>probe:Drosophila_2:1639359_at:134:647; Interrogation_Position=1427; Antisense; TCATTCAGACCTTGCGCAGCGTGAA
>probe:Drosophila_2:1639359_at:496:585; Interrogation_Position=1454; Antisense; TGGACACCAGCAACTACACATACGA
>probe:Drosophila_2:1639359_at:42:723; Interrogation_Position=1519; Antisense; TTGCCTCACGCGATCTTTATGATGA
>probe:Drosophila_2:1639359_at:274:173; Interrogation_Position=1585; Antisense; AAAGACGTGGATTTCTCGGTGCTCA
>probe:Drosophila_2:1639359_at:695:243; Interrogation_Position=1643; Antisense; AATTTGAGGCTATCTTGCGACTAGG
>probe:Drosophila_2:1639359_at:363:283; Interrogation_Position=1689; Antisense; CTGATCTATTTTTGCCAGTCACGAA

Paste this into a BLAST search page for me
GGACATTTTCCAGGCTTTTCAAGCTAGCAACGATGTGGACGACGGCCCATTCGTGCACGGAGACCTGTGGATCAAGGAAGGCACTCCACTCAAGGTGAAATTGACTTTCAAATCGCGCAGTACGGGATATCATCTTTGTGCTGTTCTCAAGTGCTGTTCTCAAGTGTGGACGTAATTATTACAACGCCTTCATTCAGACCTCATTCAGACCTTGCGCAGCGTGAATGGACACCAGCAACTACACATACGATTGCCTCACGCGATCTTTATGATGAAAAGACGTGGATTTCTCGGTGCTCAAATTTGAGGCTATCTTGCGACTAGGCTGATCTATTTTTGCCAGTCACGAA

Full Affymetrix probeset data:

Annotations for 1639359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720