Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639362_s_at:

>probe:Drosophila_2:1639362_s_at:384:453; Interrogation_Position=130; Antisense; GATAGGCAATACCTGGCGGTGATCA
>probe:Drosophila_2:1639362_s_at:264:533; Interrogation_Position=147; Antisense; GGTGATCAGGCAGGGACTATCCATA
>probe:Drosophila_2:1639362_s_at:61:341; Interrogation_Position=286; Antisense; GCTTTGGGTCGCAGCAGGAAATTTA
>probe:Drosophila_2:1639362_s_at:393:27; Interrogation_Position=310; Antisense; ATAGCCAAAGTGGAGCGCGAAGCCA
>probe:Drosophila_2:1639362_s_at:151:127; Interrogation_Position=330; Antisense; AGCCAACATTTTCGAACGCTTCGGA
>probe:Drosophila_2:1639362_s_at:477:99; Interrogation_Position=409; Antisense; AGAGGTATCTTGGTCATACTTTCCA
>probe:Drosophila_2:1639362_s_at:417:537; Interrogation_Position=420; Antisense; GGTCATACTTTCCAAATGTCTCTTT
>probe:Drosophila_2:1639362_s_at:507:599; Interrogation_Position=436; Antisense; TGTCTCTTTAAATTGGGTCGCCTGC
>probe:Drosophila_2:1639362_s_at:730:405; Interrogation_Position=51; Antisense; GACGGACTACTTTCACTACGACGAG
>probe:Drosophila_2:1639362_s_at:544:61; Interrogation_Position=528; Antisense; ATGTGAGTGCATCCATTCGGTGGCC
>probe:Drosophila_2:1639362_s_at:351:715; Interrogation_Position=543; Antisense; TTCGGTGGCCTATGCTGACTACAAG
>probe:Drosophila_2:1639362_s_at:499:307; Interrogation_Position=612; Antisense; CCACATTCGGGTCTTGGCCTCAAAA
>probe:Drosophila_2:1639362_s_at:600:229; Interrogation_Position=84; Antisense; AATGGGTCTCGAGGAGCCCATTCAC
>probe:Drosophila_2:1639362_s_at:251:125; Interrogation_Position=98; Antisense; AGCCCATTCACCTGCAGCATGAGGA

Paste this into a BLAST search page for me
GATAGGCAATACCTGGCGGTGATCAGGTGATCAGGCAGGGACTATCCATAGCTTTGGGTCGCAGCAGGAAATTTAATAGCCAAAGTGGAGCGCGAAGCCAAGCCAACATTTTCGAACGCTTCGGAAGAGGTATCTTGGTCATACTTTCCAGGTCATACTTTCCAAATGTCTCTTTTGTCTCTTTAAATTGGGTCGCCTGCGACGGACTACTTTCACTACGACGAGATGTGAGTGCATCCATTCGGTGGCCTTCGGTGGCCTATGCTGACTACAAGCCACATTCGGGTCTTGGCCTCAAAAAATGGGTCTCGAGGAGCCCATTCACAGCCCATTCACCTGCAGCATGAGGA

Full Affymetrix probeset data:

Annotations for 1639362_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime