FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639363_at:

>probe:Drosophila_2:1639363_at:315:163; Interrogation_Position=248; Antisense; AAATTGCGCCTGCAGTGCTTCAGTC
>probe:Drosophila_2:1639363_at:608:569; Interrogation_Position=284; Antisense; GGCATCTTGGGCCTGTCCAGATCAT
>probe:Drosophila_2:1639363_at:646:451; Interrogation_Position=303; Antisense; GATCATTCCGGGTGATGGACGACGA
>probe:Drosophila_2:1639363_at:699:111; Interrogation_Position=332; Antisense; AGCAAATCTCTCAGTCCCGAGGAGT
>probe:Drosophila_2:1639363_at:530:317; Interrogation_Position=381; Antisense; GCCTGGACCTGACTGATTCCGAAAT
>probe:Drosophila_2:1639363_at:181:395; Interrogation_Position=410; Antisense; GAAATGTTCTCCAGATTCGACACAG
>probe:Drosophila_2:1639363_at:185:363; Interrogation_Position=461; Antisense; GAATTCCTAGTAAAGCTGCGTCCTC
>probe:Drosophila_2:1639363_at:144:337; Interrogation_Position=475; Antisense; GCTGCGTCCTCCTATGAATAATTCG
>probe:Drosophila_2:1639363_at:17:441; Interrogation_Position=548; Antisense; GATGGCCAAATTACTGTCACCGATT
>probe:Drosophila_2:1639363_at:706:533; Interrogation_Position=589; Antisense; GGTGCGCGATCATCCGAAATACTTA
>probe:Drosophila_2:1639363_at:44:203; Interrogation_Position=632; Antisense; AACCAGATATTCACGCAGTTCCTGA
>probe:Drosophila_2:1639363_at:264:593; Interrogation_Position=669; Antisense; TGGGTGCTCCAAATCCGGATGGCAT
>probe:Drosophila_2:1639363_at:9:35; Interrogation_Position=713; Antisense; ATCAACTACTATGCCACGATCAGCG
>probe:Drosophila_2:1639363_at:514:315; Interrogation_Position=737; Antisense; GCCTCGATCGATAACGACGCTTATT

Paste this into a BLAST search page for me
AAATTGCGCCTGCAGTGCTTCAGTCGGCATCTTGGGCCTGTCCAGATCATGATCATTCCGGGTGATGGACGACGAAGCAAATCTCTCAGTCCCGAGGAGTGCCTGGACCTGACTGATTCCGAAATGAAATGTTCTCCAGATTCGACACAGGAATTCCTAGTAAAGCTGCGTCCTCGCTGCGTCCTCCTATGAATAATTCGGATGGCCAAATTACTGTCACCGATTGGTGCGCGATCATCCGAAATACTTAAACCAGATATTCACGCAGTTCCTGATGGGTGCTCCAAATCCGGATGGCATATCAACTACTATGCCACGATCAGCGGCCTCGATCGATAACGACGCTTATT

Full Affymetrix probeset data:

Annotations for 1639363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720