FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639364_at:

>probe:Drosophila_2:1639364_at:210:609; Interrogation_Position=354; Antisense; TGAGCCGCAGCGACATGATCCAACA
>probe:Drosophila_2:1639364_at:180:59; Interrogation_Position=368; Antisense; ATGATCCAACATCCCGACTGGAACG
>probe:Drosophila_2:1639364_at:65:563; Interrogation_Position=387; Antisense; GGAACGACTTCCTGAACAACGACAT
>probe:Drosophila_2:1639364_at:561:137; Interrogation_Position=480; Antisense; ACGATCGCTACAACAGCTACTCCGG
>probe:Drosophila_2:1639364_at:548:531; Interrogation_Position=529; Antisense; GGGTCTGACAGACAACAACAGCGGC
>probe:Drosophila_2:1639364_at:432:115; Interrogation_Position=548; Antisense; AGCGGCATGTCCAACTACCTGAACT
>probe:Drosophila_2:1639364_at:17:407; Interrogation_Position=602; Antisense; GACTGCCGCAACTACTACGGTAGCA
>probe:Drosophila_2:1639364_at:54:539; Interrogation_Position=620; Antisense; GGTAGCAACTACATCACCGACAACA
>probe:Drosophila_2:1639364_at:393:727; Interrogation_Position=704; Antisense; TTGGTCCTGCACGATAACAACCGCA
>probe:Drosophila_2:1639364_at:512:185; Interrogation_Position=719; Antisense; AACAACCGCATCGTGGGCATCGTAT
>probe:Drosophila_2:1639364_at:237:347; Interrogation_Position=735; Antisense; GCATCGTATCCTTCGGCAGCGGAGA
>probe:Drosophila_2:1639364_at:354:13; Interrogation_Position=787; Antisense; ATTCACTCGTGTCACCGGATACCTG
>probe:Drosophila_2:1639364_at:282:131; Interrogation_Position=830; Antisense; ACCGGCATTGTCTACTAAGAACTGT
>probe:Drosophila_2:1639364_at:713:243; Interrogation_Position=888; Antisense; AATTTCTTCTGTTTGCATATACTTA

Paste this into a BLAST search page for me
TGAGCCGCAGCGACATGATCCAACAATGATCCAACATCCCGACTGGAACGGGAACGACTTCCTGAACAACGACATACGATCGCTACAACAGCTACTCCGGGGGTCTGACAGACAACAACAGCGGCAGCGGCATGTCCAACTACCTGAACTGACTGCCGCAACTACTACGGTAGCAGGTAGCAACTACATCACCGACAACATTGGTCCTGCACGATAACAACCGCAAACAACCGCATCGTGGGCATCGTATGCATCGTATCCTTCGGCAGCGGAGAATTCACTCGTGTCACCGGATACCTGACCGGCATTGTCTACTAAGAACTGTAATTTCTTCTGTTTGCATATACTTA

Full Affymetrix probeset data:

Annotations for 1639364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720