FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639365_at:

>probe:Drosophila_2:1639365_at:242:629; Interrogation_Position=101; Antisense; TCCAAAGTCAGAAGGATCGTGAGAA
>probe:Drosophila_2:1639365_at:118:41; Interrogation_Position=116; Antisense; ATCGTGAGAAGTGGTGCCGGCTAAA
>probe:Drosophila_2:1639365_at:314:545; Interrogation_Position=127; Antisense; TGGTGCCGGCTAAACTTAGGACCCT
>probe:Drosophila_2:1639365_at:424:55; Interrogation_Position=13; Antisense; ATGAAGACTCCGCTATTTCTCCTCT
>probe:Drosophila_2:1639365_at:729:705; Interrogation_Position=142; Antisense; TTAGGACCCTACCTCGGTGGCAGAT
>probe:Drosophila_2:1639365_at:369:673; Interrogation_Position=151; Antisense; TACCTCGGTGGCAGATGCCGAAAAT
>probe:Drosophila_2:1639365_at:303:685; Interrogation_Position=26; Antisense; TATTTCTCCTCTTGGTCGTATTGGC
>probe:Drosophila_2:1639365_at:40:631; Interrogation_Position=32; Antisense; TCCTCTTGGTCGTATTGGCTTCCCT
>probe:Drosophila_2:1639365_at:425:481; Interrogation_Position=43; Antisense; GTATTGGCTTCCCTCCTGGGATTGG
>probe:Drosophila_2:1639365_at:278:569; Interrogation_Position=48; Antisense; GGCTTCCCTCCTGGGATTGGCCTTA
>probe:Drosophila_2:1639365_at:438:541; Interrogation_Position=61; Antisense; GGATTGGCCTTATCCCAGGATCGAA
>probe:Drosophila_2:1639365_at:477:577; Interrogation_Position=66; Antisense; GGCCTTATCCCAGGATCGAAATGAT
>probe:Drosophila_2:1639365_at:543:301; Interrogation_Position=74; Antisense; CCCAGGATCGAAATGATACGGAGTG
>probe:Drosophila_2:1639365_at:43:291; Interrogation_Position=92; Antisense; CGGAGTGGATCCAAAGTCAGAAGGA

Paste this into a BLAST search page for me
TCCAAAGTCAGAAGGATCGTGAGAAATCGTGAGAAGTGGTGCCGGCTAAATGGTGCCGGCTAAACTTAGGACCCTATGAAGACTCCGCTATTTCTCCTCTTTAGGACCCTACCTCGGTGGCAGATTACCTCGGTGGCAGATGCCGAAAATTATTTCTCCTCTTGGTCGTATTGGCTCCTCTTGGTCGTATTGGCTTCCCTGTATTGGCTTCCCTCCTGGGATTGGGGCTTCCCTCCTGGGATTGGCCTTAGGATTGGCCTTATCCCAGGATCGAAGGCCTTATCCCAGGATCGAAATGATCCCAGGATCGAAATGATACGGAGTGCGGAGTGGATCCAAAGTCAGAAGGA

Full Affymetrix probeset data:

Annotations for 1639365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720