FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639366_at:

>probe:Drosophila_2:1639366_at:223:27; Interrogation_Position=4624; Antisense; ATAGCATAATTAGACGTCCTTCGCA
>probe:Drosophila_2:1639366_at:205:409; Interrogation_Position=4636; Antisense; GACGTCCTTCGCAAGATAATGTTAT
>probe:Drosophila_2:1639366_at:460:213; Interrogation_Position=4668; Antisense; AAGAGCGTCAATCGGTACATCGGGC
>probe:Drosophila_2:1639366_at:634:489; Interrogation_Position=4682; Antisense; GTACATCGGGCGCTATTTCCCACTA
>probe:Drosophila_2:1639366_at:409:455; Interrogation_Position=4726; Antisense; GATAACCTAAGCTATGTATGTACAT
>probe:Drosophila_2:1639366_at:517:117; Interrogation_Position=4752; Antisense; AGCTATGTATATCCAGCCCACTTAT
>probe:Drosophila_2:1639366_at:481:309; Interrogation_Position=4769; Antisense; CCACTTATGCGCCTACTACTAGAAA
>probe:Drosophila_2:1639366_at:563:433; Interrogation_Position=4811; Antisense; GAGGTGAAACCTATAGACGCTATCA
>probe:Drosophila_2:1639366_at:221:411; Interrogation_Position=4826; Antisense; GACGCTATCACAAATGTCTATCTGA
>probe:Drosophila_2:1639366_at:505:33; Interrogation_Position=4845; Antisense; ATCTGATAGACATCGGTACTACCAA
>probe:Drosophila_2:1639366_at:562:489; Interrogation_Position=4860; Antisense; GTACTACCAATGCTATATTGCCAGT
>probe:Drosophila_2:1639366_at:284:9; Interrogation_Position=4876; Antisense; ATTGCCAGTTGTGTAATTTACTCTT
>probe:Drosophila_2:1639366_at:151:707; Interrogation_Position=4903; Antisense; TTGATCGTTTCATTTACCAGTTAAG
>probe:Drosophila_2:1639366_at:264:139; Interrogation_Position=5072; Antisense; ACGTTTTTTCTATATCTGTCTTTTG

Paste this into a BLAST search page for me
ATAGCATAATTAGACGTCCTTCGCAGACGTCCTTCGCAAGATAATGTTATAAGAGCGTCAATCGGTACATCGGGCGTACATCGGGCGCTATTTCCCACTAGATAACCTAAGCTATGTATGTACATAGCTATGTATATCCAGCCCACTTATCCACTTATGCGCCTACTACTAGAAAGAGGTGAAACCTATAGACGCTATCAGACGCTATCACAAATGTCTATCTGAATCTGATAGACATCGGTACTACCAAGTACTACCAATGCTATATTGCCAGTATTGCCAGTTGTGTAATTTACTCTTTTGATCGTTTCATTTACCAGTTAAGACGTTTTTTCTATATCTGTCTTTTG

Full Affymetrix probeset data:

Annotations for 1639366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720