FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639368_at:

>probe:Drosophila_2:1639368_at:558:497; Interrogation_Position=3273; Antisense; GTCTCCACGACCTGCGAAGTAGAAT
>probe:Drosophila_2:1639368_at:596:643; Interrogation_Position=3297; Antisense; TCTCGATTATCCCACAAGATCCGGT
>probe:Drosophila_2:1639368_at:658:211; Interrogation_Position=3312; Antisense; AAGATCCGGTTCTGTTCTCTGGAAC
>probe:Drosophila_2:1639368_at:422:585; Interrogation_Position=3331; Antisense; TGGAACACTGCGCTTCAATCTGGAT
>probe:Drosophila_2:1639368_at:251:183; Interrogation_Position=3368; Antisense; AAAAGCGACGAGTCCCTGTGGAGTG
>probe:Drosophila_2:1639368_at:169:75; Interrogation_Position=3459; Antisense; AGGACGGTGGCTCCAACTTCAGCAT
>probe:Drosophila_2:1639368_at:443:391; Interrogation_Position=3596; Antisense; GAAACCATCCAGACCAAGTTTGCTG
>probe:Drosophila_2:1639368_at:132:609; Interrogation_Position=3619; Antisense; TGAGTGCACGGTTCTAACGATCGCT
>probe:Drosophila_2:1639368_at:130:661; Interrogation_Position=3633; Antisense; TAACGATCGCTCACAGATTGCACAC
>probe:Drosophila_2:1639368_at:69:589; Interrogation_Position=3705; Antisense; TGGAGTTCGGAGCACCTCACAAGCT
>probe:Drosophila_2:1639368_at:454:65; Interrogation_Position=3744; Antisense; ATGGAGCCCTTCTTAAGCTCGTCAA
>probe:Drosophila_2:1639368_at:346:293; Interrogation_Position=3780; Antisense; CGACCACCGTAAAGTTCCTCAAGAG
>probe:Drosophila_2:1639368_at:283:51; Interrogation_Position=3824; Antisense; ATGCGCCGCAACAGAAGAGACTCCT
>probe:Drosophila_2:1639368_at:329:105; Interrogation_Position=3841; Antisense; AGACTCCTTGACCATTTCCGAAGAA

Paste this into a BLAST search page for me
GTCTCCACGACCTGCGAAGTAGAATTCTCGATTATCCCACAAGATCCGGTAAGATCCGGTTCTGTTCTCTGGAACTGGAACACTGCGCTTCAATCTGGATAAAAGCGACGAGTCCCTGTGGAGTGAGGACGGTGGCTCCAACTTCAGCATGAAACCATCCAGACCAAGTTTGCTGTGAGTGCACGGTTCTAACGATCGCTTAACGATCGCTCACAGATTGCACACTGGAGTTCGGAGCACCTCACAAGCTATGGAGCCCTTCTTAAGCTCGTCAACGACCACCGTAAAGTTCCTCAAGAGATGCGCCGCAACAGAAGAGACTCCTAGACTCCTTGACCATTTCCGAAGAA

Full Affymetrix probeset data:

Annotations for 1639368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720