FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639369_at:

>probe:Drosophila_2:1639369_at:527:441; Interrogation_Position=1066; Antisense; GATGGGAGTTCGGTGCAGCAAATCA
>probe:Drosophila_2:1639369_at:249:393; Interrogation_Position=1092; Antisense; GAAAGCGATCGCCAAACTGAAGGAT
>probe:Drosophila_2:1639369_at:13:373; Interrogation_Position=1110; Antisense; GAAGGATGACACTGCGCAACTGAAT
>probe:Drosophila_2:1639369_at:153:295; Interrogation_Position=1124; Antisense; CGCAACTGAATCTGGAGGTGGCTCT
>probe:Drosophila_2:1639369_at:552:81; Interrogation_Position=1139; Antisense; AGGTGGCTCTGCTGGTGCATGCCCA
>probe:Drosophila_2:1639369_at:628:347; Interrogation_Position=1155; Antisense; GCATGCCCACGACCAGGACATTGTG
>probe:Drosophila_2:1639369_at:551:393; Interrogation_Position=635; Antisense; GAAATCCTGAATTAGATGCTCGCAT
>probe:Drosophila_2:1639369_at:208:431; Interrogation_Position=695; Antisense; GAGTCCTGCCCCAACTGAAAGTGTT
>probe:Drosophila_2:1639369_at:368:549; Interrogation_Position=743; Antisense; GGAGGACCCACATCAGCCAGATGGA
>probe:Drosophila_2:1639369_at:363:721; Interrogation_Position=787; Antisense; TTGGAAAACTCCGATACCGCCGAGG
>probe:Drosophila_2:1639369_at:225:155; Interrogation_Position=830; Antisense; ACAGCGAGTTCACTTTCGACTTGGA
>probe:Drosophila_2:1639369_at:654:117; Interrogation_Position=890; Antisense; AGCTCAAGCCACTGATTCAGCAGTT
>probe:Drosophila_2:1639369_at:409:417; Interrogation_Position=919; Antisense; GAGCTATCCATTGAACTGTCCACCA
>probe:Drosophila_2:1639369_at:599:377; Interrogation_Position=981; Antisense; GAAGCAGACCGCAGAGCTCAACGAG

Paste this into a BLAST search page for me
GATGGGAGTTCGGTGCAGCAAATCAGAAAGCGATCGCCAAACTGAAGGATGAAGGATGACACTGCGCAACTGAATCGCAACTGAATCTGGAGGTGGCTCTAGGTGGCTCTGCTGGTGCATGCCCAGCATGCCCACGACCAGGACATTGTGGAAATCCTGAATTAGATGCTCGCATGAGTCCTGCCCCAACTGAAAGTGTTGGAGGACCCACATCAGCCAGATGGATTGGAAAACTCCGATACCGCCGAGGACAGCGAGTTCACTTTCGACTTGGAAGCTCAAGCCACTGATTCAGCAGTTGAGCTATCCATTGAACTGTCCACCAGAAGCAGACCGCAGAGCTCAACGAG

Full Affymetrix probeset data:

Annotations for 1639369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720