FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639373_at:

>probe:Drosophila_2:1639373_at:237:511; Interrogation_Position=145; Antisense; GTGCAATTGACGGACAGATACATTT
>probe:Drosophila_2:1639373_at:725:85; Interrogation_Position=172; Antisense; AGTCATTCAGTGCAGACATCCCGGG
>probe:Drosophila_2:1639373_at:435:303; Interrogation_Position=192; Antisense; CCGGGCGCAAAACGGCCAAACAGCT
>probe:Drosophila_2:1639373_at:20:181; Interrogation_Position=209; Antisense; AAACAGCTGAAGAGGTTGGGTGCAT
>probe:Drosophila_2:1639373_at:194:539; Interrogation_Position=266; Antisense; GGTAAATGTGGATGCATGCCCCGTT
>probe:Drosophila_2:1639373_at:546:345; Interrogation_Position=279; Antisense; GCATGCCCCGTTTGGAGAACAAGTT
>probe:Drosophila_2:1639373_at:143:671; Interrogation_Position=303; Antisense; TACTGGGCTCTGGACAGCTGATGGC
>probe:Drosophila_2:1639373_at:618:439; Interrogation_Position=322; Antisense; GATGGCCAGTGGATCCGATGACCGT
>probe:Drosophila_2:1639373_at:106:413; Interrogation_Position=341; Antisense; GACCGTGGCGGTGATTTCCAGCATA
>probe:Drosophila_2:1639373_at:180:345; Interrogation_Position=361; Antisense; GCATATGGTCGAGATTTGCCCAGTT
>probe:Drosophila_2:1639373_at:646:669; Interrogation_Position=393; Antisense; TACTGGGTCACTGGGAGATGAATGC
>probe:Drosophila_2:1639373_at:7:99; Interrogation_Position=408; Antisense; AGATGAATGCTCGAGTATGTACTCC
>probe:Drosophila_2:1639373_at:724:87; Interrogation_Position=421; Antisense; AGTATGTACTCCTTCAACGTTCTTA
>probe:Drosophila_2:1639373_at:474:197; Interrogation_Position=436; Antisense; AACGTTCTTACCTAAATTCTCATCA

Paste this into a BLAST search page for me
GTGCAATTGACGGACAGATACATTTAGTCATTCAGTGCAGACATCCCGGGCCGGGCGCAAAACGGCCAAACAGCTAAACAGCTGAAGAGGTTGGGTGCATGGTAAATGTGGATGCATGCCCCGTTGCATGCCCCGTTTGGAGAACAAGTTTACTGGGCTCTGGACAGCTGATGGCGATGGCCAGTGGATCCGATGACCGTGACCGTGGCGGTGATTTCCAGCATAGCATATGGTCGAGATTTGCCCAGTTTACTGGGTCACTGGGAGATGAATGCAGATGAATGCTCGAGTATGTACTCCAGTATGTACTCCTTCAACGTTCTTAAACGTTCTTACCTAAATTCTCATCA

Full Affymetrix probeset data:

Annotations for 1639373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720