FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639376_at:

>probe:Drosophila_2:1639376_at:690:91; Interrogation_Position=490; Antisense; AGTTCTTCCACATTTCACCCGATGG
>probe:Drosophila_2:1639376_at:331:129; Interrogation_Position=506; Antisense; ACCCGATGGCCAGGTGGTGCAGATC
>probe:Drosophila_2:1639376_at:142:535; Interrogation_Position=521; Antisense; GGTGCAGATCGATCGACCGCAGAAT
>probe:Drosophila_2:1639376_at:44:351; Interrogation_Position=539; Antisense; GCAGAATCTGCCCAGTGAACTGTTC
>probe:Drosophila_2:1639376_at:51:511; Interrogation_Position=553; Antisense; GTGAACTGTTCGATACACCGGTGAA
>probe:Drosophila_2:1639376_at:145:615; Interrogation_Position=574; Antisense; TGAACCAAGGTTCCGGTGCTCCCAT
>probe:Drosophila_2:1639376_at:184:263; Interrogation_Position=699; Antisense; CAGCCCACAATTTTGCCCGAGAATA
>probe:Drosophila_2:1639376_at:142:539; Interrogation_Position=743; Antisense; GGTTGGCAATCGCAAGGACTTCCTG
>probe:Drosophila_2:1639376_at:396:73; Interrogation_Position=757; Antisense; AGGACTTCCTGCGAGGTAGCTCCGA
>probe:Drosophila_2:1639376_at:348:537; Interrogation_Position=771; Antisense; GGTAGCTCCGATGCCAGCGATTGGA
>probe:Drosophila_2:1639376_at:350:223; Interrogation_Position=797; Antisense; AAGGATTCTCCTCCTGGGAGAGCGA
>probe:Drosophila_2:1639376_at:409:131; Interrogation_Position=825; Antisense; ACCGATGGTCTACTCAAGGGCCAGT
>probe:Drosophila_2:1639376_at:659:105; Interrogation_Position=892; Antisense; AGAACTTCCAGAGGGCTTTGGTCGA
>probe:Drosophila_2:1639376_at:395:551; Interrogation_Position=923; Antisense; GGAGAAGTATGCCACGCTCATCCAA

Paste this into a BLAST search page for me
AGTTCTTCCACATTTCACCCGATGGACCCGATGGCCAGGTGGTGCAGATCGGTGCAGATCGATCGACCGCAGAATGCAGAATCTGCCCAGTGAACTGTTCGTGAACTGTTCGATACACCGGTGAATGAACCAAGGTTCCGGTGCTCCCATCAGCCCACAATTTTGCCCGAGAATAGGTTGGCAATCGCAAGGACTTCCTGAGGACTTCCTGCGAGGTAGCTCCGAGGTAGCTCCGATGCCAGCGATTGGAAAGGATTCTCCTCCTGGGAGAGCGAACCGATGGTCTACTCAAGGGCCAGTAGAACTTCCAGAGGGCTTTGGTCGAGGAGAAGTATGCCACGCTCATCCAA

Full Affymetrix probeset data:

Annotations for 1639376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720