FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639377_at:

>probe:Drosophila_2:1639377_at:351:377; Interrogation_Position=115; Antisense; GAAGCTGCGTGGTCATGTGAGCCAC
>probe:Drosophila_2:1639377_at:162:361; Interrogation_Position=165; Antisense; GCAAGCATCCCGGAGGTCGCGGTAA
>probe:Drosophila_2:1639377_at:433:633; Interrogation_Position=181; Antisense; TCGCGGTAACGCTGGTGGCATGCAC
>probe:Drosophila_2:1639377_at:414:23; Interrogation_Position=229; Antisense; ATACCATCCTGGTTACTTCGGCAAG
>probe:Drosophila_2:1639377_at:619:347; Interrogation_Position=258; Antisense; GCATGAGGAACTTCCATCTGCGTCG
>probe:Drosophila_2:1639377_at:166:113; Interrogation_Position=285; Antisense; AGCACAAGTTCAGGCCCGAGATCAA
>probe:Drosophila_2:1639377_at:312:641; Interrogation_Position=321; Antisense; TCTGGTCCCTGGTCGGAGCCGAGAA
>probe:Drosophila_2:1639377_at:267:223; Interrogation_Position=377; Antisense; AAGGCTCCCGTCATCGACTTGGTTA
>probe:Drosophila_2:1639377_at:545:399; Interrogation_Position=392; Antisense; GACTTGGTTAAATTCGGCTACTACA
>probe:Drosophila_2:1639377_at:582:299; Interrogation_Position=449; Antisense; CCCGTCATCGTGAAGGCCAAGTACT
>probe:Drosophila_2:1639377_at:626:591; Interrogation_Position=516; Antisense; TGTGCTTGCTGAGCGCCTAAGTTAA
>probe:Drosophila_2:1639377_at:100:475; Interrogation_Position=536; Antisense; GTTAAGATTCCTCCTCTACAGAAGA
>probe:Drosophila_2:1639377_at:170:719; Interrogation_Position=56; Antisense; TTCGCTTCTTTCTTTCCTACAATTT
>probe:Drosophila_2:1639377_at:114:359; Interrogation_Position=566; Antisense; GCAAGTGGACTACATTCGACCATCA

Paste this into a BLAST search page for me
GAAGCTGCGTGGTCATGTGAGCCACGCAAGCATCCCGGAGGTCGCGGTAATCGCGGTAACGCTGGTGGCATGCACATACCATCCTGGTTACTTCGGCAAGGCATGAGGAACTTCCATCTGCGTCGAGCACAAGTTCAGGCCCGAGATCAATCTGGTCCCTGGTCGGAGCCGAGAAAAGGCTCCCGTCATCGACTTGGTTAGACTTGGTTAAATTCGGCTACTACACCCGTCATCGTGAAGGCCAAGTACTTGTGCTTGCTGAGCGCCTAAGTTAAGTTAAGATTCCTCCTCTACAGAAGATTCGCTTCTTTCTTTCCTACAATTTGCAAGTGGACTACATTCGACCATCA

Full Affymetrix probeset data:

Annotations for 1639377_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720