FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639378_at:

>probe:Drosophila_2:1639378_at:32:375; Interrogation_Position=1098; Antisense; GAAGAAGTTACCCATTTAACCCATG
>probe:Drosophila_2:1639378_at:35:491; Interrogation_Position=1122; Antisense; GTACACAAGTCAATTATTTCTGGAA
>probe:Drosophila_2:1639378_at:300:537; Interrogation_Position=581; Antisense; GGTAGACCTTCTCCACGATGTCTGG
>probe:Drosophila_2:1639378_at:247:599; Interrogation_Position=599; Antisense; TGTCTGGCTGGCTCGCTGGCTGTAT
>probe:Drosophila_2:1639378_at:629:581; Interrogation_Position=615; Antisense; TGGCTGTATGCCACCTTGGTCTGCC
>probe:Drosophila_2:1639378_at:492:719; Interrogation_Position=646; Antisense; TTCCACTGGAACCTCACGTGTTCAG
>probe:Drosophila_2:1639378_at:427:139; Interrogation_Position=661; Antisense; ACGTGTTCAGCACCCTTCGATACAT
>probe:Drosophila_2:1639378_at:658:295; Interrogation_Position=690; Antisense; CGAACCTGCATCCATCTGAGAAATC
>probe:Drosophila_2:1639378_at:434:75; Interrogation_Position=724; Antisense; AGGACGAAGTGCAACGGGCAGCTCC
>probe:Drosophila_2:1639378_at:688:665; Interrogation_Position=757; Antisense; TACTACTAACGCTCACCGTTCAGGT
>probe:Drosophila_2:1639378_at:495:261; Interrogation_Position=770; Antisense; CACCGTTCAGGTTTTCGCACAGAAT
>probe:Drosophila_2:1639378_at:367:25; Interrogation_Position=812; Antisense; ATAGGTATCATATTCCCAGTTTAGA
>probe:Drosophila_2:1639378_at:718:123; Interrogation_Position=881; Antisense; AGCCAAAAGCTACGCTGGTAATTTT
>probe:Drosophila_2:1639378_at:31:279; Interrogation_Position=934; Antisense; CTATTTTTATAGTTTTCTGTGGCTG

Paste this into a BLAST search page for me
GAAGAAGTTACCCATTTAACCCATGGTACACAAGTCAATTATTTCTGGAAGGTAGACCTTCTCCACGATGTCTGGTGTCTGGCTGGCTCGCTGGCTGTATTGGCTGTATGCCACCTTGGTCTGCCTTCCACTGGAACCTCACGTGTTCAGACGTGTTCAGCACCCTTCGATACATCGAACCTGCATCCATCTGAGAAATCAGGACGAAGTGCAACGGGCAGCTCCTACTACTAACGCTCACCGTTCAGGTCACCGTTCAGGTTTTCGCACAGAATATAGGTATCATATTCCCAGTTTAGAAGCCAAAAGCTACGCTGGTAATTTTCTATTTTTATAGTTTTCTGTGGCTG

Full Affymetrix probeset data:

Annotations for 1639378_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720