Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639380_a_at:

>probe:Drosophila_2:1639380_a_at:212:313; Interrogation_Position=246; Antisense; GCCACAGCCAAGATGCCCAAATTAC
>probe:Drosophila_2:1639380_a_at:537:213; Interrogation_Position=255; Antisense; AAGATGCCCAAATTACCAGCGGTTG
>probe:Drosophila_2:1639380_a_at:174:15; Interrogation_Position=266; Antisense; ATTACCAGCGGTTGGCATTGATCTT
>probe:Drosophila_2:1639380_a_at:467:263; Interrogation_Position=271; Antisense; CAGCGGTTGGCATTGATCTTGGTAC
>probe:Drosophila_2:1639380_a_at:139:571; Interrogation_Position=279; Antisense; GGCATTGATCTTGGTACCACGTACT
>probe:Drosophila_2:1639380_a_at:161:37; Interrogation_Position=286; Antisense; ATCTTGGTACCACGTACTCGTGTGT
>probe:Drosophila_2:1639380_a_at:625:487; Interrogation_Position=299; Antisense; GTACTCGTGTGTCGGTGTCTTTCAG
>probe:Drosophila_2:1639380_a_at:293:515; Interrogation_Position=307; Antisense; GTGTCGGTGTCTTTCAGCATGGCAA
>probe:Drosophila_2:1639380_a_at:344:515; Interrogation_Position=313; Antisense; GTGTCTTTCAGCATGGCAAGGTGGA
>probe:Drosophila_2:1639380_a_at:613:563; Interrogation_Position=357; Antisense; GGCAATCGAACCACGCCCAGCTATG
>probe:Drosophila_2:1639380_a_at:393:321; Interrogation_Position=371; Antisense; GCCCAGCTATGTGGCTTTCACGGAG
>probe:Drosophila_2:1639380_a_at:685:681; Interrogation_Position=378; Antisense; TATGTGGCTTTCACGGAGTCGGAGC
>probe:Drosophila_2:1639380_a_at:669:711; Interrogation_Position=387; Antisense; TTCACGGAGTCGGAGCGTCTGATCG
>probe:Drosophila_2:1639380_a_at:78:55; Interrogation_Position=438; Antisense; ATGAATCCCAACAACACGATCTTTG

Paste this into a BLAST search page for me
GCCACAGCCAAGATGCCCAAATTACAAGATGCCCAAATTACCAGCGGTTGATTACCAGCGGTTGGCATTGATCTTCAGCGGTTGGCATTGATCTTGGTACGGCATTGATCTTGGTACCACGTACTATCTTGGTACCACGTACTCGTGTGTGTACTCGTGTGTCGGTGTCTTTCAGGTGTCGGTGTCTTTCAGCATGGCAAGTGTCTTTCAGCATGGCAAGGTGGAGGCAATCGAACCACGCCCAGCTATGGCCCAGCTATGTGGCTTTCACGGAGTATGTGGCTTTCACGGAGTCGGAGCTTCACGGAGTCGGAGCGTCTGATCGATGAATCCCAACAACACGATCTTTG

Full Affymetrix probeset data:

Annotations for 1639380_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime