Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639381_at:

>probe:Drosophila_2:1639381_at:177:299; Interrogation_Position=1350; Antisense; CCGAAATTGCATTGGACTCCGATTC
>probe:Drosophila_2:1639381_at:386:463; Interrogation_Position=1370; Antisense; GATTCGGACGGATGCAGGTCATCAT
>probe:Drosophila_2:1639381_at:509:497; Interrogation_Position=1387; Antisense; GTCATCATTGGATTGGCCCTGCTAA
>probe:Drosophila_2:1639381_at:582:581; Interrogation_Position=1400; Antisense; TGGCCCTGCTAATCCACAATTTTAG
>probe:Drosophila_2:1639381_at:232:701; Interrogation_Position=1419; Antisense; TTTTAGGTTCGAATTGCATCCCAAG
>probe:Drosophila_2:1639381_at:502:45; Interrogation_Position=1436; Antisense; ATCCCAAGACGCCAGTGCCAATGAA
>probe:Drosophila_2:1639381_at:35:653; Interrogation_Position=1469; Antisense; TCAATAACCTTTTGCTGGGCTCCGA
>probe:Drosophila_2:1639381_at:224:83; Interrogation_Position=1493; Antisense; AGGGCGGAATCCATCTCAATATCAC
>probe:Drosophila_2:1639381_at:370:59; Interrogation_Position=1640; Antisense; ATGTTCATAGATTGCTTCTGCCAAG
>probe:Drosophila_2:1639381_at:639:463; Interrogation_Position=1649; Antisense; GATTGCTTCTGCCAAGAAATGCCGA
>probe:Drosophila_2:1639381_at:704:167; Interrogation_Position=1731; Antisense; AAAGGCAATATATCACCCAGAAAAT
>probe:Drosophila_2:1639381_at:75:487; Interrogation_Position=1800; Antisense; GTAGTTAGTTATCCACAAGCATGCT
>probe:Drosophila_2:1639381_at:533:347; Interrogation_Position=1818; Antisense; GCATGCTACTGCGATTAGACACTAA
>probe:Drosophila_2:1639381_at:497:421; Interrogation_Position=1868; Antisense; GAGCAACATTGTTTCTGGAATTCCA

Paste this into a BLAST search page for me
CCGAAATTGCATTGGACTCCGATTCGATTCGGACGGATGCAGGTCATCATGTCATCATTGGATTGGCCCTGCTAATGGCCCTGCTAATCCACAATTTTAGTTTTAGGTTCGAATTGCATCCCAAGATCCCAAGACGCCAGTGCCAATGAATCAATAACCTTTTGCTGGGCTCCGAAGGGCGGAATCCATCTCAATATCACATGTTCATAGATTGCTTCTGCCAAGGATTGCTTCTGCCAAGAAATGCCGAAAAGGCAATATATCACCCAGAAAATGTAGTTAGTTATCCACAAGCATGCTGCATGCTACTGCGATTAGACACTAAGAGCAACATTGTTTCTGGAATTCCA

Full Affymetrix probeset data:

Annotations for 1639381_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime