FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639382_at:

>probe:Drosophila_2:1639382_at:217:47; Interrogation_Position=116; Antisense; ATCCGCCTCTGGCTGAGTGTGCATA
>probe:Drosophila_2:1639382_at:570:345; Interrogation_Position=136; Antisense; GCATACACGTACGTTGTGGCCTGGA
>probe:Drosophila_2:1639382_at:375:365; Interrogation_Position=167; Antisense; GAATAGCCATATTAACCGCCGGATC
>probe:Drosophila_2:1639382_at:239:611; Interrogation_Position=194; Antisense; TGAAAGTTACGCCTGATCCCCGAGT
>probe:Drosophila_2:1639382_at:550:45; Interrogation_Position=209; Antisense; ATCCCCGAGTGCGTTTGGTCAATGG
>probe:Drosophila_2:1639382_at:273:13; Interrogation_Position=234; Antisense; ATTCAATCTGCAGATACGCGACGCC
>probe:Drosophila_2:1639382_at:57:547; Interrogation_Position=267; Antisense; GGATGCCGGCGATTATATCTGCCAG
>probe:Drosophila_2:1639382_at:543:23; Interrogation_Position=281; Antisense; ATATCTGCCAGATTGCCACTATGGA
>probe:Drosophila_2:1639382_at:137:465; Interrogation_Position=291; Antisense; GATTGCCACTATGGATCCACGTGAA
>probe:Drosophila_2:1639382_at:611:509; Interrogation_Position=311; Antisense; GTGAAATCACCCACACGGTCGAGAT
>probe:Drosophila_2:1639382_at:486:33; Interrogation_Position=32; Antisense; ATCAAGTGGGTGTTACTGAGTGCCT
>probe:Drosophila_2:1639382_at:325:669; Interrogation_Position=45; Antisense; TACTGAGTGCCTGTCTGACTCTCAT
>probe:Drosophila_2:1639382_at:148:611; Interrogation_Position=60; Antisense; TGACTCTCATCCAGTGTTGTTCATG
>probe:Drosophila_2:1639382_at:137:641; Interrogation_Position=92; Antisense; TCTGCGGTTTATATTCCACTCTGGA

Paste this into a BLAST search page for me
ATCCGCCTCTGGCTGAGTGTGCATAGCATACACGTACGTTGTGGCCTGGAGAATAGCCATATTAACCGCCGGATCTGAAAGTTACGCCTGATCCCCGAGTATCCCCGAGTGCGTTTGGTCAATGGATTCAATCTGCAGATACGCGACGCCGGATGCCGGCGATTATATCTGCCAGATATCTGCCAGATTGCCACTATGGAGATTGCCACTATGGATCCACGTGAAGTGAAATCACCCACACGGTCGAGATATCAAGTGGGTGTTACTGAGTGCCTTACTGAGTGCCTGTCTGACTCTCATTGACTCTCATCCAGTGTTGTTCATGTCTGCGGTTTATATTCCACTCTGGA

Full Affymetrix probeset data:

Annotations for 1639382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720