Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639384_s_at:

>probe:Drosophila_2:1639384_s_at:423:473; Interrogation_Position=2976; Antisense; GTTCATTGTTATACGCACTTTCTTG
>probe:Drosophila_2:1639384_s_at:269:259; Interrogation_Position=2991; Antisense; CACTTTCTTGCTTTTTATTACTACG
>probe:Drosophila_2:1639384_s_at:358:615; Interrogation_Position=3206; Antisense; TGAATGCAGGCACACACTCGCTTAA
>probe:Drosophila_2:1639384_s_at:142:145; Interrogation_Position=3221; Antisense; ACTCGCTTAAAGCTCTTTGTTGCAA
>probe:Drosophila_2:1639384_s_at:20:727; Interrogation_Position=3237; Antisense; TTGTTGCAAAACTCCCGACTATGTG
>probe:Drosophila_2:1639384_s_at:557:403; Interrogation_Position=3253; Antisense; GACTATGTGCCTCATACGGAACGAG
>probe:Drosophila_2:1639384_s_at:386:31; Interrogation_Position=3299; Antisense; ATAATCGCCCATTATTACCCTTGAT
>probe:Drosophila_2:1639384_s_at:215:669; Interrogation_Position=3314; Antisense; TACCCTTGATTTAGAACTCCCCAAT
>probe:Drosophila_2:1639384_s_at:133:385; Interrogation_Position=3327; Antisense; GAACTCCCCAATGGTATGTCCAGAT
>probe:Drosophila_2:1639384_s_at:370:461; Interrogation_Position=3349; Antisense; GATTTTCTGCAGCTGCGGAGGCTAA
>probe:Drosophila_2:1639384_s_at:37:623; Interrogation_Position=3395; Antisense; TGCCAAGGTTTTTTGTCTATCCCAC
>probe:Drosophila_2:1639384_s_at:190:645; Interrogation_Position=3410; Antisense; TCTATCCCACGCCAAGGTGTTTGAT
>probe:Drosophila_2:1639384_s_at:34:483; Interrogation_Position=3454; Antisense; GTATATGTTTGCAATCTCTCTCTCC
>probe:Drosophila_2:1639384_s_at:588:643; Interrogation_Position=3472; Antisense; TCTCTCCTTAAACGATACCCAGTGT

Paste this into a BLAST search page for me
GTTCATTGTTATACGCACTTTCTTGCACTTTCTTGCTTTTTATTACTACGTGAATGCAGGCACACACTCGCTTAAACTCGCTTAAAGCTCTTTGTTGCAATTGTTGCAAAACTCCCGACTATGTGGACTATGTGCCTCATACGGAACGAGATAATCGCCCATTATTACCCTTGATTACCCTTGATTTAGAACTCCCCAATGAACTCCCCAATGGTATGTCCAGATGATTTTCTGCAGCTGCGGAGGCTAATGCCAAGGTTTTTTGTCTATCCCACTCTATCCCACGCCAAGGTGTTTGATGTATATGTTTGCAATCTCTCTCTCCTCTCTCCTTAAACGATACCCAGTGT

Full Affymetrix probeset data:

Annotations for 1639384_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime