Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639389_at:

>probe:Drosophila_2:1639389_at:339:173; Interrogation_Position=114; Antisense; AAAGAAACTTCCCATCTGGCCACTG
>probe:Drosophila_2:1639389_at:74:581; Interrogation_Position=130; Antisense; TGGCCACTGACCCATTTTCGCAGAT
>probe:Drosophila_2:1639389_at:612:297; Interrogation_Position=148; Antisense; CGCAGATTCCCGACATTGATTAAAT
>probe:Drosophila_2:1639389_at:574:453; Interrogation_Position=165; Antisense; GATTAAATCCCACGCAAGTTCCGAA
>probe:Drosophila_2:1639389_at:457:575; Interrogation_Position=223; Antisense; GGCGTATCCAATATGAAGCTACCCT
>probe:Drosophila_2:1639389_at:553:339; Interrogation_Position=240; Antisense; GCTACCCTACTTTATAAGCCCAAGG
>probe:Drosophila_2:1639389_at:499:199; Interrogation_Position=255; Antisense; AAGCCCAAGGTGTGTTCAAAATCAG
>probe:Drosophila_2:1639389_at:131:231; Interrogation_Position=306; Antisense; AATGTTCACCTACAACTATCATCCG
>probe:Drosophila_2:1639389_at:73:253; Interrogation_Position=318; Antisense; CAACTATCATCCGTTTTCCATTTAC
>probe:Drosophila_2:1639389_at:238:183; Interrogation_Position=33; Antisense; AAAACCGAATTCGAGCTCAGAGCTC
>probe:Drosophila_2:1639389_at:155:165; Interrogation_Position=348; Antisense; AAATGAAGCTACTCTTCGCGCCAAG
>probe:Drosophila_2:1639389_at:157:719; Interrogation_Position=362; Antisense; TTCGCGCCAAGCAAGCAGCAGATGA
>probe:Drosophila_2:1639389_at:477:27; Interrogation_Position=580; Antisense; ATAAACTCACCGCAGCCTAGTTAGG
>probe:Drosophila_2:1639389_at:714:723; Interrogation_Position=91; Antisense; TTGACCACGATGAGAGGCAGCGCAA

Paste this into a BLAST search page for me
AAAGAAACTTCCCATCTGGCCACTGTGGCCACTGACCCATTTTCGCAGATCGCAGATTCCCGACATTGATTAAATGATTAAATCCCACGCAAGTTCCGAAGGCGTATCCAATATGAAGCTACCCTGCTACCCTACTTTATAAGCCCAAGGAAGCCCAAGGTGTGTTCAAAATCAGAATGTTCACCTACAACTATCATCCGCAACTATCATCCGTTTTCCATTTACAAAACCGAATTCGAGCTCAGAGCTCAAATGAAGCTACTCTTCGCGCCAAGTTCGCGCCAAGCAAGCAGCAGATGAATAAACTCACCGCAGCCTAGTTAGGTTGACCACGATGAGAGGCAGCGCAA

Full Affymetrix probeset data:

Annotations for 1639389_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime