FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639390_at:

>probe:Drosophila_2:1639390_at:374:31; Interrogation_Position=142; Antisense; ATAAAAGACGACCAGTTCCCATCCA
>probe:Drosophila_2:1639390_at:164:47; Interrogation_Position=162; Antisense; ATCCAGGGCCACCAGTGAATTACAA
>probe:Drosophila_2:1639390_at:629:59; Interrogation_Position=210; Antisense; ATGTTCCAGCGATCTTTCGACAGAG
>probe:Drosophila_2:1639390_at:524:685; Interrogation_Position=279; Antisense; TATAGCTTTGCTTTCGGCGAATGCG
>probe:Drosophila_2:1639390_at:545:93; Interrogation_Position=308; Antisense; AGTTGCGATTCCTGATCACCTATAA
>probe:Drosophila_2:1639390_at:165:297; Interrogation_Position=333; Antisense; CGACAAGGCTTCCACGTACATATAC
>probe:Drosophila_2:1639390_at:291:15; Interrogation_Position=364; Antisense; ATTATGGTGATACTTTCCCTGGTGC
>probe:Drosophila_2:1639390_at:496:535; Interrogation_Position=384; Antisense; GGTGCTGCAGCTTTTAGTTGGCATA
>probe:Drosophila_2:1639390_at:567:231; Interrogation_Position=408; Antisense; AATGCTGATCTTTAAACGACGTCTC
>probe:Drosophila_2:1639390_at:23:99; Interrogation_Position=423; Antisense; ACGACGTCTCAAGCGATTTAGGAAC
>probe:Drosophila_2:1639390_at:437:85; Interrogation_Position=501; Antisense; AGTGATCAACATTCTGCTGGCCGCA
>probe:Drosophila_2:1639390_at:398:581; Interrogation_Position=518; Antisense; TGGCCGCATTTACCACAACGGATGG
>probe:Drosophila_2:1639390_at:42:383; Interrogation_Position=64; Antisense; GAAAGTTTCGCCAGTACAACCAGTG
>probe:Drosophila_2:1639390_at:730:83; Interrogation_Position=85; Antisense; AGTGGACCATGTTGCGGTTCTGGCA

Paste this into a BLAST search page for me
ATAAAAGACGACCAGTTCCCATCCAATCCAGGGCCACCAGTGAATTACAAATGTTCCAGCGATCTTTCGACAGAGTATAGCTTTGCTTTCGGCGAATGCGAGTTGCGATTCCTGATCACCTATAACGACAAGGCTTCCACGTACATATACATTATGGTGATACTTTCCCTGGTGCGGTGCTGCAGCTTTTAGTTGGCATAAATGCTGATCTTTAAACGACGTCTCACGACGTCTCAAGCGATTTAGGAACAGTGATCAACATTCTGCTGGCCGCATGGCCGCATTTACCACAACGGATGGGAAAGTTTCGCCAGTACAACCAGTGAGTGGACCATGTTGCGGTTCTGGCA

Full Affymetrix probeset data:

Annotations for 1639390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720