FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639392_at:

>probe:Drosophila_2:1639392_at:154:317; Interrogation_Position=1001; Antisense; GCCTCGCCTCAGAAAGCATGTATGC
>probe:Drosophila_2:1639392_at:691:357; Interrogation_Position=1077; Antisense; GCAACGAGCCTTTTATCGCCAGTGG
>probe:Drosophila_2:1639392_at:125:527; Interrogation_Position=1128; Antisense; GGGACCTACGTCAGTTTCAGAGCAA
>probe:Drosophila_2:1639392_at:71:205; Interrogation_Position=1154; Antisense; AAGCCGATTGCCACTTTTAAGCACC
>probe:Drosophila_2:1639392_at:202:555; Interrogation_Position=1183; Antisense; GGACCACATCACTACTGTCGAATGG
>probe:Drosophila_2:1639392_at:38:597; Interrogation_Position=1198; Antisense; TGTCGAATGGAGTCCCGCAGAGGCT
>probe:Drosophila_2:1639392_at:354:97; Interrogation_Position=1216; Antisense; AGAGGCTACCGTACTGGCGTCAGGC
>probe:Drosophila_2:1639392_at:344:73; Interrogation_Position=1284; Antisense; AGGACATCGATCAGGCGGTGGACCC
>probe:Drosophila_2:1639392_at:596:441; Interrogation_Position=1322; Antisense; GATGTCCTAAACAAGTTGCCACCGC
>probe:Drosophila_2:1639392_at:377:361; Interrogation_Position=1345; Antisense; GCAATTGCTTTTTATTCACCAGGGA
>probe:Drosophila_2:1639392_at:260:461; Interrogation_Position=1378; Antisense; GATTAAAGAGCTACACTGGCACCCT
>probe:Drosophila_2:1639392_at:417:571; Interrogation_Position=1439; Antisense; GGCTTTAATATCTTTCGCACGATCA
>probe:Drosophila_2:1639392_at:508:413; Interrogation_Position=1470; Antisense; GACCTCGCTATTATTCTGTTTCTTA
>probe:Drosophila_2:1639392_at:592:13; Interrogation_Position=1506; Antisense; ATTAAACCGATCTTGTGTCTTTGGG

Paste this into a BLAST search page for me
GCCTCGCCTCAGAAAGCATGTATGCGCAACGAGCCTTTTATCGCCAGTGGGGGACCTACGTCAGTTTCAGAGCAAAAGCCGATTGCCACTTTTAAGCACCGGACCACATCACTACTGTCGAATGGTGTCGAATGGAGTCCCGCAGAGGCTAGAGGCTACCGTACTGGCGTCAGGCAGGACATCGATCAGGCGGTGGACCCGATGTCCTAAACAAGTTGCCACCGCGCAATTGCTTTTTATTCACCAGGGAGATTAAAGAGCTACACTGGCACCCTGGCTTTAATATCTTTCGCACGATCAGACCTCGCTATTATTCTGTTTCTTAATTAAACCGATCTTGTGTCTTTGGG

Full Affymetrix probeset data:

Annotations for 1639392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720