Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639393_at:

>probe:Drosophila_2:1639393_at:407:81; Interrogation_Position=2172; Antisense; AGGGCTGGTGTTATCTTTTTGCAAA
>probe:Drosophila_2:1639393_at:196:729; Interrogation_Position=2211; Antisense; TTGGAGCGGTTCTTTTTCGCCACTA
>probe:Drosophila_2:1639393_at:437:695; Interrogation_Position=2225; Antisense; TTTCGCCACTATCTCGTGCAATATG
>probe:Drosophila_2:1639393_at:43:511; Interrogation_Position=2240; Antisense; GTGCAATATGAGCTGGACTCTCGAA
>probe:Drosophila_2:1639393_at:334:585; Interrogation_Position=2253; Antisense; TGGACTCTCGAATGTCCCTGTGTCA
>probe:Drosophila_2:1639393_at:274:503; Interrogation_Position=2266; Antisense; GTCCCTGTGTCACTCAAGTCTTGAA
>probe:Drosophila_2:1639393_at:708:217; Interrogation_Position=2281; Antisense; AAGTCTTGAACACAACACTCTCTCA
>probe:Drosophila_2:1639393_at:622:187; Interrogation_Position=2294; Antisense; AACACTCTCTCACACTGATCGAATG
>probe:Drosophila_2:1639393_at:480:279; Interrogation_Position=2302; Antisense; CTCACACTGATCGAATGCGGTTTCC
>probe:Drosophila_2:1639393_at:677:173; Interrogation_Position=2355; Antisense; AAAGCCAATCAAACACCTGATCCAC
>probe:Drosophila_2:1639393_at:315:459; Interrogation_Position=2381; Antisense; GATTCACCGATCACCAAACATAAAC
>probe:Drosophila_2:1639393_at:310:245; Interrogation_Position=2411; Antisense; AATTACTCAACTTTGTCTATCCCCA
>probe:Drosophila_2:1639393_at:154:727; Interrogation_Position=2423; Antisense; TTGTCTATCCCCACCAATAAACAGG
>probe:Drosophila_2:1639393_at:496:249; Interrogation_Position=2437; Antisense; CAATAAACAGGCTGCGCGACTGTCT

Paste this into a BLAST search page for me
AGGGCTGGTGTTATCTTTTTGCAAATTGGAGCGGTTCTTTTTCGCCACTATTTCGCCACTATCTCGTGCAATATGGTGCAATATGAGCTGGACTCTCGAATGGACTCTCGAATGTCCCTGTGTCAGTCCCTGTGTCACTCAAGTCTTGAAAAGTCTTGAACACAACACTCTCTCAAACACTCTCTCACACTGATCGAATGCTCACACTGATCGAATGCGGTTTCCAAAGCCAATCAAACACCTGATCCACGATTCACCGATCACCAAACATAAACAATTACTCAACTTTGTCTATCCCCATTGTCTATCCCCACCAATAAACAGGCAATAAACAGGCTGCGCGACTGTCT

Full Affymetrix probeset data:

Annotations for 1639393_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime