FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639394_at:

>probe:Drosophila_2:1639394_at:361:609; Interrogation_Position=108; Antisense; TGAGCCAAACTTTGACCCTTTGCTG
>probe:Drosophila_2:1639394_at:365:693; Interrogation_Position=126; Antisense; TTTGCTGCCTTGCATTGGTGGCATG
>probe:Drosophila_2:1639394_at:116:85; Interrogation_Position=166; Antisense; AGTGTCCACCAACGATACCGCTTGT
>probe:Drosophila_2:1639394_at:587:189; Interrogation_Position=193; Antisense; AACTTTTTGCCCCAGTATCTACAAG
>probe:Drosophila_2:1639394_at:344:77; Interrogation_Position=249; Antisense; AGGAGTTTGCTAGCACCTGCAATCT
>probe:Drosophila_2:1639394_at:71:617; Interrogation_Position=266; Antisense; TGCAATCTTTTGTCCCACAACTGTC
>probe:Drosophila_2:1639394_at:142:225; Interrogation_Position=298; Antisense; AAGGAATAGCGTGCAGGCCTATGCT
>probe:Drosophila_2:1639394_at:128:225; Interrogation_Position=401; Antisense; AAGGAATGCTTCAAGCCCTGCTCGA
>probe:Drosophila_2:1639394_at:390:621; Interrogation_Position=419; Antisense; TGCTCGATGATCTACCAGCCGGTGT
>probe:Drosophila_2:1639394_at:167:263; Interrogation_Position=434; Antisense; CAGCCGGTGTGCATTACCAATGGAA
>probe:Drosophila_2:1639394_at:38:217; Interrogation_Position=458; Antisense; AAGTATCGTGCCGAGTTGGCCAACT
>probe:Drosophila_2:1639394_at:608:117; Interrogation_Position=540; Antisense; AGCTCTTCCGTCTTTTGCGCGAAGA
>probe:Drosophila_2:1639394_at:233:189; Interrogation_Position=604; Antisense; AACAGGACCATCTTTTGTTCGTCAA
>probe:Drosophila_2:1639394_at:517:493; Interrogation_Position=624; Antisense; GTCAAAGTCATCCTTTTGTCTTCGA

Paste this into a BLAST search page for me
TGAGCCAAACTTTGACCCTTTGCTGTTTGCTGCCTTGCATTGGTGGCATGAGTGTCCACCAACGATACCGCTTGTAACTTTTTGCCCCAGTATCTACAAGAGGAGTTTGCTAGCACCTGCAATCTTGCAATCTTTTGTCCCACAACTGTCAAGGAATAGCGTGCAGGCCTATGCTAAGGAATGCTTCAAGCCCTGCTCGATGCTCGATGATCTACCAGCCGGTGTCAGCCGGTGTGCATTACCAATGGAAAAGTATCGTGCCGAGTTGGCCAACTAGCTCTTCCGTCTTTTGCGCGAAGAAACAGGACCATCTTTTGTTCGTCAAGTCAAAGTCATCCTTTTGTCTTCGA

Full Affymetrix probeset data:

Annotations for 1639394_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720