FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639395_at:

>probe:Drosophila_2:1639395_at:533:259; Interrogation_Position=196; Antisense; CACTCCTGTGGTGGTGCCATAATAA
>probe:Drosophila_2:1639395_at:497:29; Interrogation_Position=217; Antisense; ATAAACGAGACCTTCGTCCTGACAG
>probe:Drosophila_2:1639395_at:278:337; Interrogation_Position=244; Antisense; GCTCACTGTGTCGAAAATGCCTTTA
>probe:Drosophila_2:1639395_at:192:235; Interrogation_Position=259; Antisense; AATGCCTTTATTCCATGGCTGGTTG
>probe:Drosophila_2:1639395_at:456:287; Interrogation_Position=277; Antisense; CTGGTTGTCGTCACGGGCACTAATA
>probe:Drosophila_2:1639395_at:251:257; Interrogation_Position=376; Antisense; CACAATGATATTGCCCTGTTGGAAT
>probe:Drosophila_2:1639395_at:434:247; Interrogation_Position=411; Antisense; AATTGCTTGGGACGAGCGCACTCAG
>probe:Drosophila_2:1639395_at:384:443; Interrogation_Position=472; Antisense; GATGAAGTAATCCTCACTGGTTGGG
>probe:Drosophila_2:1639395_at:177:301; Interrogation_Position=523; Antisense; CCCATCGATTTGCAGGTTCTATACC
>probe:Drosophila_2:1639395_at:140:671; Interrogation_Position=553; Antisense; TACGTTCCCCATCGCGAGTGCAAAG
>probe:Drosophila_2:1639395_at:594:509; Interrogation_Position=570; Antisense; GTGCAAAGCCCTGCTGAGCAACGAT
>probe:Drosophila_2:1639395_at:62:21; Interrogation_Position=616; Antisense; ATTTGCACTTTTTCGCGGCTGGGAG
>probe:Drosophila_2:1639395_at:677:79; Interrogation_Position=642; Antisense; AGGTGCCTGCCATGGAGATTCCGGT
>probe:Drosophila_2:1639395_at:469:413; Interrogation_Position=668; Antisense; GACCTCTGGTCAGCAATGGTTACCT

Paste this into a BLAST search page for me
CACTCCTGTGGTGGTGCCATAATAAATAAACGAGACCTTCGTCCTGACAGGCTCACTGTGTCGAAAATGCCTTTAAATGCCTTTATTCCATGGCTGGTTGCTGGTTGTCGTCACGGGCACTAATACACAATGATATTGCCCTGTTGGAATAATTGCTTGGGACGAGCGCACTCAGGATGAAGTAATCCTCACTGGTTGGGCCCATCGATTTGCAGGTTCTATACCTACGTTCCCCATCGCGAGTGCAAAGGTGCAAAGCCCTGCTGAGCAACGATATTTGCACTTTTTCGCGGCTGGGAGAGGTGCCTGCCATGGAGATTCCGGTGACCTCTGGTCAGCAATGGTTACCT

Full Affymetrix probeset data:

Annotations for 1639395_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720