FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639397_at:

>probe:Drosophila_2:1639397_at:661:227; Interrogation_Position=378; Antisense; AATGGCCACGATGTCGCCGTGCTGC
>probe:Drosophila_2:1639397_at:381:403; Interrogation_Position=403; Antisense; GACTTCGCAACTCGCTGACCTTTAA
>probe:Drosophila_2:1639397_at:117:49; Interrogation_Position=475; Antisense; ATGCCACCGTGGACATCTCCGGCTG
>probe:Drosophila_2:1639397_at:490:643; Interrogation_Position=541; Antisense; TCTACGTGCAGGTGAAGGCCCTATC
>probe:Drosophila_2:1639397_at:55:279; Interrogation_Position=561; Antisense; CTATCCCGGGAATCTTGCCAGAAGA
>probe:Drosophila_2:1639397_at:271:109; Interrogation_Position=580; Antisense; AGAAGACGTACTTACGCCAGCTGCC
>probe:Drosophila_2:1639397_at:155:119; Interrogation_Position=598; Antisense; AGCTGCCGGAAACCACGATGTGCCT
>probe:Drosophila_2:1639397_at:92:63; Interrogation_Position=615; Antisense; ATGTGCCTGCTGCATCCCAAGGATA
>probe:Drosophila_2:1639397_at:492:45; Interrogation_Position=628; Antisense; ATCCCAAGGATAAGGGTGCCTGCTA
>probe:Drosophila_2:1639397_at:516:267; Interrogation_Position=681; Antisense; CAGGGCAAACTGGTCGGCTTGGCCA
>probe:Drosophila_2:1639397_at:299:569; Interrogation_Position=696; Antisense; GGCTTGGCCAGTTTCGTCATCGGTG
>probe:Drosophila_2:1639397_at:328:571; Interrogation_Position=744; Antisense; GGCTACGAAAGGGTCTCCAAACTGA
>probe:Drosophila_2:1639397_at:589:195; Interrogation_Position=763; Antisense; AACTGAGGAATTGGATCGCCGAGAA
>probe:Drosophila_2:1639397_at:711:195; Interrogation_Position=813; Antisense; AACGAGGTCCGGAAATCACGCAAAG

Paste this into a BLAST search page for me
AATGGCCACGATGTCGCCGTGCTGCGACTTCGCAACTCGCTGACCTTTAAATGCCACCGTGGACATCTCCGGCTGTCTACGTGCAGGTGAAGGCCCTATCCTATCCCGGGAATCTTGCCAGAAGAAGAAGACGTACTTACGCCAGCTGCCAGCTGCCGGAAACCACGATGTGCCTATGTGCCTGCTGCATCCCAAGGATAATCCCAAGGATAAGGGTGCCTGCTACAGGGCAAACTGGTCGGCTTGGCCAGGCTTGGCCAGTTTCGTCATCGGTGGGCTACGAAAGGGTCTCCAAACTGAAACTGAGGAATTGGATCGCCGAGAAAACGAGGTCCGGAAATCACGCAAAG

Full Affymetrix probeset data:

Annotations for 1639397_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720