FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639398_at:

>probe:Drosophila_2:1639398_at:418:363; Interrogation_Position=2288; Antisense; GAATTCCTACTATTATCTTCTGCGA
>probe:Drosophila_2:1639398_at:293:645; Interrogation_Position=2303; Antisense; TCTTCTGCGAAGATATCTGGAGAGT
>probe:Drosophila_2:1639398_at:52:85; Interrogation_Position=2325; Antisense; AGTGTTTATTCTGGCTGTGAGGCGA
>probe:Drosophila_2:1639398_at:557:389; Interrogation_Position=2350; Antisense; GAAACGCGTTTATCAAGCTAATCCA
>probe:Drosophila_2:1639398_at:555:183; Interrogation_Position=2374; Antisense; AAAAGATTTCAGATGTGGAGCGTCT
>probe:Drosophila_2:1639398_at:13:363; Interrogation_Position=2426; Antisense; GAATGTTAACCCATCCCAGGTGGAG
>probe:Drosophila_2:1639398_at:3:555; Interrogation_Position=2447; Antisense; GGAGCCCTTGCTGCGTGAAATATTC
>probe:Drosophila_2:1639398_at:316:181; Interrogation_Position=2478; Antisense; AAAAATCACTAGACAACCGATGCGT
>probe:Drosophila_2:1639398_at:390:201; Interrogation_Position=2492; Antisense; AACCGATGCGTGTCGGGCATTTAAT
>probe:Drosophila_2:1639398_at:181:711; Interrogation_Position=2512; Antisense; TTAATGCCTATGTTGATGCCCAATG
>probe:Drosophila_2:1639398_at:612:61; Interrogation_Position=2574; Antisense; ATGTCTGTTTTATCTTGTCGCTTGT
>probe:Drosophila_2:1639398_at:49:705; Interrogation_Position=2681; Antisense; TTAGGATACCAAGTGCAAAGCAACA
>probe:Drosophila_2:1639398_at:244:59; Interrogation_Position=2714; Antisense; ATGTAATGTACACCGTTTACCTAGT
>probe:Drosophila_2:1639398_at:459:189; Interrogation_Position=2770; Antisense; AACTTGGAAGCGTGGGTTCTGTGCA

Paste this into a BLAST search page for me
GAATTCCTACTATTATCTTCTGCGATCTTCTGCGAAGATATCTGGAGAGTAGTGTTTATTCTGGCTGTGAGGCGAGAAACGCGTTTATCAAGCTAATCCAAAAAGATTTCAGATGTGGAGCGTCTGAATGTTAACCCATCCCAGGTGGAGGGAGCCCTTGCTGCGTGAAATATTCAAAAATCACTAGACAACCGATGCGTAACCGATGCGTGTCGGGCATTTAATTTAATGCCTATGTTGATGCCCAATGATGTCTGTTTTATCTTGTCGCTTGTTTAGGATACCAAGTGCAAAGCAACAATGTAATGTACACCGTTTACCTAGTAACTTGGAAGCGTGGGTTCTGTGCA

Full Affymetrix probeset data:

Annotations for 1639398_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720