Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639401_at:

>probe:Drosophila_2:1639401_at:568:437; Interrogation_Position=1249; Antisense; GAGGACACCGTTGATCCGAATGCGT
>probe:Drosophila_2:1639401_at:433:173; Interrogation_Position=1351; Antisense; AAAGCAGGCTTCACCAGTGCCGATC
>probe:Drosophila_2:1639401_at:378:475; Interrogation_Position=1383; Antisense; GTTACCAGTGGCTGATGACTACAAA
>probe:Drosophila_2:1639401_at:339:327; Interrogation_Position=1475; Antisense; GCGTGCGCAAGGAGCCATCTTTTCG
>probe:Drosophila_2:1639401_at:189:271; Interrogation_Position=1490; Antisense; CATCTTTTCGCCAGGGAGAACTCAA
>probe:Drosophila_2:1639401_at:621:253; Interrogation_Position=1512; Antisense; CAACATTCAGGCAATCGACGACGAT
>probe:Drosophila_2:1639401_at:256:213; Interrogation_Position=1562; Antisense; AAGACCGGAAGCGATCTCTATGTAA
>probe:Drosophila_2:1639401_at:680:491; Interrogation_Position=1583; Antisense; GTAATCGTTCTCAACCTGGGTAGCA
>probe:Drosophila_2:1639401_at:171:593; Interrogation_Position=1599; Antisense; TGGGTAGCACCTCCAAGACCTTGGA
>probe:Drosophila_2:1639401_at:46:215; Interrogation_Position=1631; Antisense; AAGTATTACGAACTGGGCACCCAGG
>probe:Drosophila_2:1639401_at:132:549; Interrogation_Position=1657; Antisense; GGAGGTCATTACCACGTCCTTGAGC
>probe:Drosophila_2:1639401_at:308:609; Interrogation_Position=1677; Antisense; TGAGCTCCCAGTACATCGATGGCGA
>probe:Drosophila_2:1639401_at:346:233; Interrogation_Position=1710; Antisense; AATCTACGGAGTTCGTTGCCAATCC
>probe:Drosophila_2:1639401_at:209:303; Interrogation_Position=1746; Antisense; CCGTCCTAGTGGCTGTCTAAGCTAA

Paste this into a BLAST search page for me
GAGGACACCGTTGATCCGAATGCGTAAAGCAGGCTTCACCAGTGCCGATCGTTACCAGTGGCTGATGACTACAAAGCGTGCGCAAGGAGCCATCTTTTCGCATCTTTTCGCCAGGGAGAACTCAACAACATTCAGGCAATCGACGACGATAAGACCGGAAGCGATCTCTATGTAAGTAATCGTTCTCAACCTGGGTAGCATGGGTAGCACCTCCAAGACCTTGGAAAGTATTACGAACTGGGCACCCAGGGGAGGTCATTACCACGTCCTTGAGCTGAGCTCCCAGTACATCGATGGCGAAATCTACGGAGTTCGTTGCCAATCCCCGTCCTAGTGGCTGTCTAAGCTAA

Full Affymetrix probeset data:

Annotations for 1639401_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime