Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639405_at:

>probe:Drosophila_2:1639405_at:612:693; Interrogation_Position=5931; Antisense; TTTGCTGGGCTATTGTTTATATATC
>probe:Drosophila_2:1639405_at:265:279; Interrogation_Position=5955; Antisense; CTACCGATATCGTACACACACTATA
>probe:Drosophila_2:1639405_at:394:13; Interrogation_Position=6044; Antisense; ATTAACTTTTGCAAGCGCGGCAGCC
>probe:Drosophila_2:1639405_at:714:303; Interrogation_Position=6067; Antisense; CCGAGGATCAGGGTAGACATCTAAC
>probe:Drosophila_2:1639405_at:645:481; Interrogation_Position=6116; Antisense; GTATCTTCAGGTGTTTCCAGTGTGA
>probe:Drosophila_2:1639405_at:134:663; Interrogation_Position=6150; Antisense; TACAGGATCGTGTCGGCTAGGGTTC
>probe:Drosophila_2:1639405_at:87:303; Interrogation_Position=6174; Antisense; CCGGTGCCGCATGCCTAATAGGTTA
>probe:Drosophila_2:1639405_at:730:371; Interrogation_Position=6226; Antisense; GAAGGAGAGCGTTCAGCTGTGAATA
>probe:Drosophila_2:1639405_at:439:513; Interrogation_Position=6275; Antisense; GTGATCTTACGAAAGCTTCAAGTGA
>probe:Drosophila_2:1639405_at:126:701; Interrogation_Position=6343; Antisense; TTTTTTCGCCTCAAGAAGCGATGGT
>probe:Drosophila_2:1639405_at:686:343; Interrogation_Position=6389; Antisense; GCATTTGGATCTGCTTTTGTTAATT
>probe:Drosophila_2:1639405_at:640:653; Interrogation_Position=6409; Antisense; TAATTTACAACCTTCTGGATCCCGA
>probe:Drosophila_2:1639405_at:599:641; Interrogation_Position=6422; Antisense; TCTGGATCCCGAAAACGCAACGTTT
>probe:Drosophila_2:1639405_at:350:357; Interrogation_Position=6438; Antisense; GCAACGTTTTACCATTACTATTACT

Paste this into a BLAST search page for me
TTTGCTGGGCTATTGTTTATATATCCTACCGATATCGTACACACACTATAATTAACTTTTGCAAGCGCGGCAGCCCCGAGGATCAGGGTAGACATCTAACGTATCTTCAGGTGTTTCCAGTGTGATACAGGATCGTGTCGGCTAGGGTTCCCGGTGCCGCATGCCTAATAGGTTAGAAGGAGAGCGTTCAGCTGTGAATAGTGATCTTACGAAAGCTTCAAGTGATTTTTTCGCCTCAAGAAGCGATGGTGCATTTGGATCTGCTTTTGTTAATTTAATTTACAACCTTCTGGATCCCGATCTGGATCCCGAAAACGCAACGTTTGCAACGTTTTACCATTACTATTACT

Full Affymetrix probeset data:

Annotations for 1639405_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime