FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639406_at:

>probe:Drosophila_2:1639406_at:629:29; Interrogation_Position=1008; Antisense; ATAAATGTGCGCGTGTTTGTTTTCA
>probe:Drosophila_2:1639406_at:488:601; Interrogation_Position=464; Antisense; TGTTCCTCCACGAGTTCGACGTGAA
>probe:Drosophila_2:1639406_at:291:579; Interrogation_Position=513; Antisense; GGCCTGGCAGGCGAACAACATGGAT
>probe:Drosophila_2:1639406_at:8:189; Interrogation_Position=529; Antisense; AACATGGATTCCTTGCAGCAGAAGC
>probe:Drosophila_2:1639406_at:36:103; Interrogation_Position=569; Antisense; AGAGCAGCGCCCAGGACTATATCCA
>probe:Drosophila_2:1639406_at:301:131; Interrogation_Position=650; Antisense; ACCTCTATCTGGACGGGTGCATCGA
>probe:Drosophila_2:1639406_at:133:623; Interrogation_Position=707; Antisense; TGCGCTTCATCATAGTGTCCTGGGT
>probe:Drosophila_2:1639406_at:700:83; Interrogation_Position=720; Antisense; AGTGTCCTGGGTGCTAGTGGCCTTC
>probe:Drosophila_2:1639406_at:246:83; Interrogation_Position=735; Antisense; AGTGGCCTTCGAGTTAATCTGCTTC
>probe:Drosophila_2:1639406_at:573:291; Interrogation_Position=768; Antisense; CGTGTTTCTGGCCATTAGTTTTAAG
>probe:Drosophila_2:1639406_at:371:261; Interrogation_Position=799; Antisense; CAGCGACGGATGGAGTTCTAGTTCT
>probe:Drosophila_2:1639406_at:425:675; Interrogation_Position=817; Antisense; TAGTTCTAGGCCTTCGGTAATCTCG
>probe:Drosophila_2:1639406_at:39:537; Interrogation_Position=832; Antisense; GGTAATCTCGAGCTATCCAACAGTA
>probe:Drosophila_2:1639406_at:655:531; Interrogation_Position=871; Antisense; GGGTCTCGCTGATATTTTTCTCTTC

Paste this into a BLAST search page for me
ATAAATGTGCGCGTGTTTGTTTTCATGTTCCTCCACGAGTTCGACGTGAAGGCCTGGCAGGCGAACAACATGGATAACATGGATTCCTTGCAGCAGAAGCAGAGCAGCGCCCAGGACTATATCCAACCTCTATCTGGACGGGTGCATCGATGCGCTTCATCATAGTGTCCTGGGTAGTGTCCTGGGTGCTAGTGGCCTTCAGTGGCCTTCGAGTTAATCTGCTTCCGTGTTTCTGGCCATTAGTTTTAAGCAGCGACGGATGGAGTTCTAGTTCTTAGTTCTAGGCCTTCGGTAATCTCGGGTAATCTCGAGCTATCCAACAGTAGGGTCTCGCTGATATTTTTCTCTTC

Full Affymetrix probeset data:

Annotations for 1639406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720