FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639409_at:

>probe:Drosophila_2:1639409_at:17:601; Interrogation_Position=1022; Antisense; TGTACGCGAACTGCTGGTCAATCTG
>probe:Drosophila_2:1639409_at:36:495; Interrogation_Position=1038; Antisense; GTCAATCTGCATGCGGGCGGCTTAA
>probe:Drosophila_2:1639409_at:448:437; Interrogation_Position=1143; Antisense; GAGGACCAGCCTGTAGTCATCGAAC
>probe:Drosophila_2:1639409_at:249:485; Interrogation_Position=1155; Antisense; GTAGTCATCGAACTTCCGGAAGCCT
>probe:Drosophila_2:1639409_at:351:447; Interrogation_Position=753; Antisense; GATGCTGTTGACAAACTGCTCGAAG
>probe:Drosophila_2:1639409_at:4:545; Interrogation_Position=781; Antisense; TTGAAACGGCCGATGGACTCATTGA
>probe:Drosophila_2:1639409_at:36:563; Interrogation_Position=806; Antisense; GGAACTGCAGCTGGCTTACGCATTT
>probe:Drosophila_2:1639409_at:26:707; Interrogation_Position=821; Antisense; TTACGCATTTTTCCTAGTGGGCTAC
>probe:Drosophila_2:1639409_at:322:679; Interrogation_Position=835; Antisense; TAGTGGGCTACTCTGTGGAGTCTCT
>probe:Drosophila_2:1639409_at:717:207; Interrogation_Position=873; Antisense; AAGCTTTTGGGCTTGCTGGCTCACT
>probe:Drosophila_2:1639409_at:84:141; Interrogation_Position=903; Antisense; ACGGCGGTCACCAAGCACAAGTTAA
>probe:Drosophila_2:1639409_at:392:395; Interrogation_Position=935; Antisense; GAAATACAGCGAGGTTTTGGCCCAC
>probe:Drosophila_2:1639409_at:566:119; Interrogation_Position=982; Antisense; AGCTGATGGTGCCTGGTCCGCATAA
>probe:Drosophila_2:1639409_at:23:505; Interrogation_Position=997; Antisense; GTCCGCATAACACCGTCTACAAAGA

Paste this into a BLAST search page for me
TGTACGCGAACTGCTGGTCAATCTGGTCAATCTGCATGCGGGCGGCTTAAGAGGACCAGCCTGTAGTCATCGAACGTAGTCATCGAACTTCCGGAAGCCTGATGCTGTTGACAAACTGCTCGAAGTTGAAACGGCCGATGGACTCATTGAGGAACTGCAGCTGGCTTACGCATTTTTACGCATTTTTCCTAGTGGGCTACTAGTGGGCTACTCTGTGGAGTCTCTAAGCTTTTGGGCTTGCTGGCTCACTACGGCGGTCACCAAGCACAAGTTAAGAAATACAGCGAGGTTTTGGCCCACAGCTGATGGTGCCTGGTCCGCATAAGTCCGCATAACACCGTCTACAAAGA

Full Affymetrix probeset data:

Annotations for 1639409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720