Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639410_at:

>probe:Drosophila_2:1639410_at:495:387; Interrogation_Position=270; Antisense; GAAACGGCCTTCAAAAAGTTCTGCA
>probe:Drosophila_2:1639410_at:673:153; Interrogation_Position=316; Antisense; ACAGATTCTGTTACTACCTCGGCGG
>probe:Drosophila_2:1639410_at:364:497; Interrogation_Position=339; Antisense; GGTCTGGAAGAATCCGCCACGGGCA
>probe:Drosophila_2:1639410_at:637:607; Interrogation_Position=376; Antisense; TGAGCAAACCCCTCAGTTGGTCCAT
>probe:Drosophila_2:1639410_at:574:591; Interrogation_Position=393; Antisense; TGGTCCATGCCAGCTGAGAAGATCT
>probe:Drosophila_2:1639410_at:461:165; Interrogation_Position=445; Antisense; AAATCTGCGACCTTCGCTATGAGAA
>probe:Drosophila_2:1639410_at:211:109; Interrogation_Position=499; Antisense; AGAAGCTGAAGGTACGCGACCTGAA
>probe:Drosophila_2:1639410_at:378:387; Interrogation_Position=524; Antisense; GAAAATCCTCAACGACTGGGACGAG
>probe:Drosophila_2:1639410_at:292:371; Interrogation_Position=569; Antisense; GAAGGGCGACTTCATCAAGCGTATC
>probe:Drosophila_2:1639410_at:16:615; Interrogation_Position=601; Antisense; TGAAGCCCAAGTACTCGCGCAGCGA
>probe:Drosophila_2:1639410_at:115:417; Interrogation_Position=632; Antisense; GAGCGCAGTCAGTTACTTGTGTAGT
>probe:Drosophila_2:1639410_at:419:485; Interrogation_Position=652; Antisense; GTAGTTACATGGAACACGCCCACTT
>probe:Drosophila_2:1639410_at:198:387; Interrogation_Position=663; Antisense; GAACACGCCCACTTAGCTAAAACAA
>probe:Drosophila_2:1639410_at:428:129; Interrogation_Position=827; Antisense; ACCTCGTCCTCTCAAACGGTTGATA

Paste this into a BLAST search page for me
GAAACGGCCTTCAAAAAGTTCTGCAACAGATTCTGTTACTACCTCGGCGGGGTCTGGAAGAATCCGCCACGGGCATGAGCAAACCCCTCAGTTGGTCCATTGGTCCATGCCAGCTGAGAAGATCTAAATCTGCGACCTTCGCTATGAGAAAGAAGCTGAAGGTACGCGACCTGAAGAAAATCCTCAACGACTGGGACGAGGAAGGGCGACTTCATCAAGCGTATCTGAAGCCCAAGTACTCGCGCAGCGAGAGCGCAGTCAGTTACTTGTGTAGTGTAGTTACATGGAACACGCCCACTTGAACACGCCCACTTAGCTAAAACAAACCTCGTCCTCTCAAACGGTTGATA

Full Affymetrix probeset data:

Annotations for 1639410_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime