FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639411_at:

>probe:Drosophila_2:1639411_at:314:79; Interrogation_Position=2443; Antisense; AGGTTGCCCTTGATCTGCAGCAAGC
>probe:Drosophila_2:1639411_at:82:361; Interrogation_Position=2462; Antisense; GCAAGCGGCCATTAACAAGCTGTGA
>probe:Drosophila_2:1639411_at:596:205; Interrogation_Position=2478; Antisense; AAGCTGTGAAACTAGTCCCCACCAT
>probe:Drosophila_2:1639411_at:727:667; Interrogation_Position=2533; Antisense; TACATATACTATACCCAGTTCGCTG
>probe:Drosophila_2:1639411_at:414:301; Interrogation_Position=2546; Antisense; CCCAGTTCGCTGATCATGATTGTAC
>probe:Drosophila_2:1639411_at:473:21; Interrogation_Position=2573; Antisense; ATATATAGACCCACCTCAAGAGCAT
>probe:Drosophila_2:1639411_at:551:115; Interrogation_Position=2593; Antisense; AGCATATCTCATTATTGCACCCAGA
>probe:Drosophila_2:1639411_at:498:147; Interrogation_Position=2644; Antisense; ACTAGGCCACATTTACTTACCTCAA
>probe:Drosophila_2:1639411_at:317:709; Interrogation_Position=2656; Antisense; TTACTTACCTCAAGCCGCAGGCAGA
>probe:Drosophila_2:1639411_at:24:387; Interrogation_Position=2861; Antisense; GAACACGAAGGCGACCCAAGTGCAT
>probe:Drosophila_2:1639411_at:82:305; Interrogation_Position=2889; Antisense; CCTCATCGCCCAGTGGCAAAGAATT
>probe:Drosophila_2:1639411_at:582:253; Interrogation_Position=2905; Antisense; CAAAGAATTTTGCACTATCCCCATC
>probe:Drosophila_2:1639411_at:615:45; Interrogation_Position=2921; Antisense; ATCCCCATCATGTATAGTTCGAATA
>probe:Drosophila_2:1639411_at:176:471; Interrogation_Position=2937; Antisense; GTTCGAATAGTCTTGTAGCTAACCT

Paste this into a BLAST search page for me
AGGTTGCCCTTGATCTGCAGCAAGCGCAAGCGGCCATTAACAAGCTGTGAAAGCTGTGAAACTAGTCCCCACCATTACATATACTATACCCAGTTCGCTGCCCAGTTCGCTGATCATGATTGTACATATATAGACCCACCTCAAGAGCATAGCATATCTCATTATTGCACCCAGAACTAGGCCACATTTACTTACCTCAATTACTTACCTCAAGCCGCAGGCAGAGAACACGAAGGCGACCCAAGTGCATCCTCATCGCCCAGTGGCAAAGAATTCAAAGAATTTTGCACTATCCCCATCATCCCCATCATGTATAGTTCGAATAGTTCGAATAGTCTTGTAGCTAACCT

Full Affymetrix probeset data:

Annotations for 1639411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720